{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

lecture3 - H DNA triple helix spontaneously forms produces...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon
pu 1/2 mirror repeat Triple Helix H DNA • triple helix spontaneously forms • produces sharp bend Draw your own triple helix sequence! Other 1/2 mirror repeat
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Triple Base Pairs
Background image of page 2
Triple Base Pairs --one pair uses standard Watson-Crick pairing --other pair uses Hoogsteen pairing --the third strand lies in the major groove of the duplex
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
RNA Helical Structure • stabilized by base stacking • stacking forces are stronger between 2 pu than 2 pyr or alternating pu/pyr Fig.10-25 Lehninger et al.
Background image of page 4
Complex Folding Patterns for RNA • G:U base pairs frequently occur • Hairpins are most common type of secondary structure • Can be predicted by computer programs Single Strands Bulge Internal Loop Hairpin • symmetric internal loops have the same number of unpaired bases on each side of the loop • asymmetric internal loops have different numbers of unpaired bases on each side of the loop • mismatch has base on each side that is unpaired
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
GAAAACUAAACCAUACACCACCAACACAACCAAACCCACCACGCCCAAUUG UACACACCCGCUUGAAAAAGCAAGUCUGACAAAUGGCCAAAGUGCGCGAG UUUACCAAUCCUUUACAGACUCCACCACAAAAACUCUCAUCCAAGAUGAG CUUAUAGAAAUAUUCGUCCCAUCAUGGAAAAACAUAAACUAGCUAACCCG RNA folding web site Extra Credit Assignment: Due 1/25/08 Login to Zuker’s web site. Michael Zuker’s site: http://mfold.bioinfo.rpi.edu/cgi-bin/rna-form1.cgi Insert sequence below. Print out the following (can use jpg format):
Background image of page 6
Image of page 7
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 21

lecture3 - H DNA triple helix spontaneously forms produces...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online