{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

comparison - Part 2 Comparative Analysis of RNAs c S.Will...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
c S.Will Part 2 Comparative Analysis of RNAs
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA M68929 GCGGAUAU-AACUUAGGGGUUAAAGUUGCAGAUUGUGGCUC---------UGAAAA-CACGGGUUCGAAUCCCGUUAUUCGCC X02172 GCCUUUAU-AGCUUAG-UGGUAAAGCGAUAAACUGAAGAUU---------UAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA Z11880 GCCUUCCU-AGCUCAG-UGGUAGAGCGCACGGCUUUUAACC---------GUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG consensus (((((((...(((( ........ ))))(((((( ....... )) ......... )))) .... ((((( ....... )))))))))))). Remarks Usually, we only know the sequences of RNAs. Why? For evolution: sequence AND structure. Why?
Background image of page 2
c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA M68929 GCGGAUAU-AACUUAGGGGUUAAAGUUGCAGAUUGUGGCUC---------UGAAAA-CACGGGUUCGAAUCCCGUUAUUCGCC X02172 GCCUUUAU-AGCUUAG-UGGUAAAGCGAUAAACUGAAGAUU---------UAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA Z11880 GCCUUCCU-AGCUCAG-UGGUAGAGCGCACGGCUUUUAACC---------GUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG consensus (((((((...(((( ........ ))))(((((( ....... )) ......... )))) .... ((((( ....... )))))))))))). Remarks Usually, we only know the sequences of RNAs. Why? For evolution: sequence AND structure. Why?
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA M68929 GCGGAUAU-AACUUAGGGGUUAAAGUUGCAGAUUGUGGCUC---------UGAAAA-CACGGGUUCGAAUCCCGUUAUUCGCC X02172 GCCUUUAU-AGCUUAG-UGGUAAAGCGAUAAACUGAAGAUU---------UAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA Z11880 GCCUUCCU-AGCUCAG-UGGUAGAGCGCACGGCUUUUAACC---------GUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG consensus (((((((...(((( ........ ))))(((((( ....... )) ......... )))) .... ((((( ....... )))))))))))).
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}