comparison - c S.Will Part 2 Comparative Analysis of RNAs c...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: c S.Will Part 2 Comparative Analysis of RNAs c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA M68929 GCGGAUAU-AACUUAGGGGUUAAAGUUGCAGAUUGUGGCUC---------UGAAAA-CACGGGUUCGAAUCCCGUUAUUCGCC X02172 GCCUUUAU-AGCUUAG-UGGUAAAGCGAUAAACUGAAGAUU---------UAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA Z11880 GCCUUCCU-AGCUCAG-UGGUAGAGCGCACGGCUUUUAACC---------GUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG consensus (((((((...((((........))))((((((.......)).........))))....(((((.......)))))))))))). Remarks Usually, we only know the sequences of RNAs. Why? For evolution: sequence AND structure. Why? c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA M68929 GCGGAUAU-AACUUAGGGGUUAAAGUUGCAGAUUGUGGCUC---------UGAAAA-CACGGGUUCGAAUCCCGUUAUUCGCC X02172 GCCUUUAU-AGCUUAG-UGGUAAAGCGAUAAACUGAAGAUU---------UAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA Z11880 GCCUUCCU-AGCUCAG-UGGUAGAGCGCACGGCUUUUAACC---------GUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG consensus (((((((...((((........))))((((((.......)).........))))....(((((.......)))))))))))). Remarks Usually, we only know the sequences of RNAs. Why? For evolution: sequence AND structure. Why? c S.Will Example Given : set of related RNA sequences >AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >X02172 GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA >Z11880 GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG >D10744 GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG Wanted : learn about evolutionary relation AF008220 GGAGGAUU-AGCUCAGCUGGGAGAGCAUCUGCCUUACAAGC---------AGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA...
View Full Document

This note was uploaded on 04/06/2010 for the course COMPUTER S COMP5647 taught by Professor Dr.ping during the Spring '10 term at York University.

Page1 / 82

comparison - c S.Will Part 2 Comparative Analysis of RNAs c...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online