bch208-09 - Lab VI: Computational Biology gy and RNA...

Info iconThis preview shows pages 1–14. Sign up to view the full content.

View Full Document Right Arrow Icon
Lab VI: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Contact Info: David_Mathews@urmc.rochester.edu • Phone: x51734 • Office: 3.6830 (across the hall from your wet lab) •W e b : h t t p://rna.urmc.rochester.edu
Background image of page 2
Outline: • Define Bioinformatics and Computational Biology. xplain why RNA is important and interesting • Explain why RNA is important and interesting. • Background in RNA structure. omparative sequence analysis • Comparative sequence analysis. • Free energy model for quantifying structure stability. i i i t i b d i i • Free energy minimization by dynamic programming algorithm. artition function calculations of base pair probabilities • Partition function calculations of base pair probabilities. • A few words about Thursday’s lab.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Definitions: • Bioinformatics is the derivation of new knowledge about Biology by the analysis of data. • Computational Biology is the use of computers to develop and test hypotheses about Biology. • These terms are often used interchangeably.
Background image of page 4
hy RNA structure Prediction: Why RNA structure Prediction: • This is what I study, so I can teach the field ell well. • I also authored the software we will use for lab, so I know it well and it is free. • This is a paradigm for computational biology. – It is not so important that we are predicting RNA structure, but that you have an opportunity to solve a problem with the help of computation.
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Central Dogma of Biology:
Background image of page 6
RNA is an Active Player: ntisense Antisense Antibiotics
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
RNA Secondary and Tertiary Structure: C A AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG CCUUGCAAAGGGUAUGGUA P5 P5a 120 200 G G G G U C A A C A G C C G U U C A G G C U G A C G G A U G G U C C U GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA P4 P5c 180 260 G C G G G A A A U A C C A C A A AGG G UA U G G U A A U A A A A C C A C G CU CA P6 P5b 140 160 20 A A U U A G U C U C A G G U U U G A G A U G G C C U U G A G C C A A G C A G U P6a 220 G G A A A C G U C C U A A G U CG A U A U G G A U P6b 240 A A C A G A U C U U C U G U U Cate, et al. (Cech & Doudna). (1996) Science 273 :1678. Waring & Davies. (1984) Gene 28 : 277.
Background image of page 8
Base Pairs:
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
elices: Helices:
Background image of page 10
An RNA Secondary Structure: R2 Retrotransposon 3’ UTR from D. melanogaster . Mathews et al ., RNA 3 :1-16. On average, 46 % of nucleotides are unpaired.
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Predicting Secondary Structure is an Important Problem: secondary structure provides insight into how an RNA • A secondary structure provides insight into how an RNA functions. – A predicted structures provides a framework for making hypotheses about structure. • A secondary structure is needed for determining a tertiary ructure structure. – Building constructs for structural biology (NMR and crystallography) – Assignments • This is a paradigm of (structural) Computational Biology.
Background image of page 12
Comparative Sequence Analysis of NA S d St t RNA Secondary Structure: ccurate method for predicting RNA secondary
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 14
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 69

bch208-09 - Lab VI: Computational Biology gy and RNA...

This preview shows document pages 1 - 14. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online