{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

phylo1 - HMM Training Baum-Welch Algorithm Christopher Lee...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
HMM Training: Baum-Welch Algorithm Christopher Lee December 1, 2009
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
How to model gene evolution? atggggctcagcgacggggagtggcagcaggtgctgaacgtctgggggaa atggggctcagtgatggggagtggcagatggtgctgaacatctgggggaa atggctgatcatgatctggttctgaagtgctggggagccgtggaggccga atggctaactatgacatggttctgcagtgctgggggccagtggaggctga 1
Background image of page 2
Evolution as a Markov Chain? Presumably, evolution from a given ancestor A depends only on sequence of A , not on its ancestors. But discrete time assumption no longer tenable. 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Continuous Time Markov Chains For a homogeneous process; define state probability vec- tor π ( t ) and transition matrix at time t as T ( t ) : π ( t ) = π ( t = 0 ) T ( t ) T ( t + Δ t ) = T ( t ) T ( Δ t ) Define instantaneous rate matrix Λ : Λ = lim Δ t 0 T ( Δ t ) - I Δ t 3
Background image of page 4
Matrix Exponential We can then calculate T ( t ) as T ( t ) = e Λ t where for a square matrix M e M = I + M + M 2 2! + ... + M i i ! + ... = i = 0 M i i ! Elegant, but not easy to calculate generally... 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Simple Mutation Model Assumptions Neutral: mutation only; no selection Reversible: π i λ i j = π j λ ji Independence: λ i j = π j μ 5
Background image of page 6
F81 Model (Felsenstein)
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}