Restriction_Enzy21461 - E LABORATORY Restriction Enzymes I...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: E LABORATORY Restriction Enzymes I . INTRODUCTION Bacteriavmemchbttl’efizstbfiflefl’rnlogists Yes, lcmgbeforel’nmensbegan tomtDflAaflephoegem,bactedamereusirgrestrictimeizwestopmtect thereelvee frunoertainwruss.Eactedcfi1ag$(viruss that attadcbectezia) are omstantlyatte'tptingtoim/adebacteria. Raetrictimeuzymelflcealleizyresare proteins and they prevent: invasion of foreign INA sources (bacteriqahages) 12y cutting this foreigimjntopiers. These pieces of IZNAttmcemot functicn. 'Eeeuzymearecelleimstrictimmzwsbedwsedeyratfictttemfecdmof bacteriqhageearxiveredisooveredintheBSO’s. A. Reetriction Enzymes — HON do they work? Wamnaytypesofresuictimeazwesafieadimefirfisapartiwlarm sequence and wtsitmafiazpardoflarplace. 'Iheee cittjngplaoee are called restrictimsites. Ebdurestdcticneizwehasitsmnmfiqerestzictimsite. The resuictimsitalocatedeEDAstreflusnllymeistof4to8basepaim Iteyaredescrjbedaspalmdrmdcbecausemeyreadfliesarebadmrdsand famards. Fbreerrple, 5 ’ GGATCC3 ' 3 ' CCTAGGS ’ the ccxrplementary strarxisl'alethesaresequeloemimreadS' to 3’. Restriction enzymes cut the D\1Abackbone between the same two bases on each strarri. Sate refitriction elzynes make staggered cuts in the quosite Stan‘s creating complementary, single stranded ends and other ratricticn enzymes make a wt across both strands creating INA fragments with “blunt“ 31b. Ushgdelansofprdoabflityymcaipredictfmoftmarstricfimsitemfiflomr. Pbrafwr~base seqene, amt-riotimsitewilloocurrarmrflyezery256basee. Because DNA sequences are not random, some DNA molecules will have many restricting site foraqaecificezzwemtfileotl'nersvmlhavefeu. ‘mesizes ofthese fragrents (firectlycnrreegcxfito tl'edistarnebemeeqthe EtriCticn sitee. rIhe following tafleh's:s a few of the Wrestriction enzynes and the [NA sequences recognized. The bold face letters indicate the regim of the overlatpirg, singlestrarristl'meenzymcreateardtl'em (*) iniicatestl'lesiteof oijjrg. '2004 by mtenwt Publishing, LLC Restriction Enzyme DNA Sequence Recognized EcoRl BamHl Bacillus amyloliquefaciens Haemophilus influenzae Escherichia coli 5'G *AATTC 3'CTTAA*G 5’G*GATCC 3’CCTAG*G 5’A*AGCTT 3’TTCGA*A Haemophilus haemolyticus 5’GTT*AAC 3’CAA*TTG Moraxella bovis 5 ’ *GATC 3’CTAG* 5’T*CGA 3’AGC*T Thermus aquaticus Notl Nacardia otitidi's HpaI Haemophilus parainfluenzae 5’GC*GGCCGC 3’CGCCGG*CG 5’GTT*AAC 3’CAA*TTG Lab 1 Restriction Enzymes 3 The mama of restriction enzyma cane frcm the bacteria species name followed byaRmianmmeral. ’meRaranmreral, I, inflicatesthatitmasthefixstauzwe famjnt‘tatpartiqflar specia (Earple: E. oolRestrictimaizyne I— EtcflI). Intl'iefollom'ngsequaace, EooRIwasusedtowtastrandofm restriction enzyme G AATTC ATTC H CTTAA G 3:13: H on“ J3: .. Notice that the line drawn in the first diagram indicates the restriction enzyme site and how a cut is made. The top strand is the same as the bot- tom strand, read 5' to 3'. The second diagram shows the two fragments that are produced by this cut. These fragments are uneven and have over- hanging chains or sticky ends. These protruding ends will base pair easily with complementary sequences of bases. Using the following sequence of DNA and the restriction enzyme, Mbo I, find each restriction site and cut it using your pencil. DNA 5'GATCTAGGCCTTCCGATC'ITAAGATCCTAAGGGATC 3'CTAGATCCGGAAGGCTAGAATTCTAGGATTCCCTAG 1. How many fragments are produced? 2. How many bases are in each fragment? 3. Are sticky ends produced? Now using the following DNA strand and the restriction enzyme, Bam Hl, find each restriction site and cut it using your pencil. DNA 5'GGATCCTAAGCCGGATCCGTGTAAACCCGGATCC 3'CCTAGGATTCGGCCTAGGACATITGGGCCATGG 4. How many fragments are produced? 5. How many bases are in each fragment? 6. Are sticky ends produced? ...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern