320-14&15 - Genetics, part 2: from genotype to...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Genetics, part 2: from genotype to phenotype office: Centers for Molecular Medicine, room 447 (just over the 4th floor bridge from Life Sciences) Hours: drop by any time, or email for an appointment: mkernan@notes.cc.sunysb.edu Maurice Kernan Dept. of Neurobiology & Ctr. for Developmental Genetics my research: uses Drosophila genetics to study mechanosensory transduction - how sound and touch are converted to electrical signals in the nervous system. Why I do (and teach) genetics The unifying basis for biology: the universal logic of life. A powerful set of tools to engineer living systems. A way to discover molecules and mechanisms in biology. An analytical technique, a way of thinking - not just a set of facts A new type of knowledge about ourselves A new window on our past A transforming force in medicine, law and politics. 14-16 Basics of gene expression - getting from DNA to protein; - regulating gene expression (in bacteria) Genotype Phenotype Gene expression Gene transmission 17-19 Tools & techniques- recombinant DNA - DNA cloning & amplification - sequencing & genomics - analysing variant genotypes 24-26 Change, variation & complexity- population genetics, human evolution- genetics of quantitative & complex traits - heritability in humans; behavioral genetics 20-23 Gene expression in eukaryotes: - chromosomes & expression: imprinting - cell cycle regulation and cancer genetics - gene expression and development. Proteins carry out most biochemical functions Genes control phenotype because they can encode proteins. DNA is inert - it has little biochemical activity Genotype 1 gene Phenotype 1 enzyme polypeptide C NH 2 X C O N H C C O OH O C C H N Z Y Protein structure C NH 2 COOH X C NH 2 COOH Y C NH 2 COOH Z The sequence hypothesis: all protein properties determined by 1 o amino-acid sequence Text fig. 7.23 Levels of polypeptide structure Genotype base sequence DNA base sequence RNA Phenotype amino acid sequence Protein Information flows from DNA to RNA to protein - the Central Dogma of molecular biology. How does it work? - a genetic code How did it get started? 1. How geneticists & biochemists cracked the code- clues from protein sequences and bacterial genetics - identifying the RNA message - using synthetic messages to read the code dictionary 2. How cells read the code - a simplifying assumption: the sequence hypothesis Theoretically possible codes: CGATGTTACCGTAGCTGCTA Punctuated? CGA , TGT , TAC , CGT , AGC , TGC , TA Reading frame? CGATGTTACCGTAGCTGCTA Overlapping? Fig. 7.25 Properties of the code: clues from proteins Many mutations change single amino acids in a polypeptide Any amino acid can be followed by any other in protein sequences....
View Full Document

This note was uploaded on 04/21/2010 for the course BIO 89329 taught by Professor Hollingsworth during the Spring '10 term at SUNY Stony Brook.

Page1 / 70

320-14&15 - Genetics, part 2: from genotype to...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online