Cellexam1practice - BIOL 4374/BCHS 4313 Cell Biology Exam#1...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS#_____________________ Name_____________________ This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The base in the wobble position of a codon: answer - b a) is the 5’ (first) base. b) is the 3’ (third) base. c) is the second base. d) often contains adenine. 2. (4) The enzyme aminoacyltransferase pairs __________tRNA___________ with the proper _________amino acid______________ . 3. (2) The following mRNA would encode a protein containing _____9_____ amino acids. 5’ GAUCACCCACCAUGGUACAUCUACAUACAUUACAGGACUGACAUGUAAUAG 3’ 4. (2) What enzyme within the ribosome is responsible for making peptide bonds? Peptidyl transferase 5. (2) During the initiation of translation, the mRNA is associated with the ___small_____ ribosomal subunit. 6. (2) During the elongation phase of translation, the growing peptide chain bound to the tRNA in the _____P_____ site is donated to the aminoacyl-tRNA in the ____A ____ site through the formation of a peptide bond.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 7. (2) Monomeric proteins do not contain a: answer - d a) primary structure b) secondary structure c) tertiary structure d) quaternary struucture 8. (2) Chaperones assist in the: answer - a a) proper folding of proteins b) degradation of unfolded proteins c) transport of proteins outside the cell d) formation of peptide bonds 9. (2) What molecule constitutes a signal that targets proteins to be degraded in the proteasome? Ubiquitin 10. (2) All of the following statements about enzymes are true except: answer - b a) enzymes lower the activation energy of a reaction b) enzymes typically react with many different substrates c) enzymes catalyze reactions in aqueous solutions d) enzymes increase the rate of a reaction 11. (2) The activity of which protein in regulated by allosteric release of catalytic subunits? a)
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/25/2010 for the course LIFE SCIEN Genetics taught by Professor Chen during the Spring '10 term at UCLA.

Page1 / 6

Cellexam1practice - BIOL 4374/BCHS 4313 Cell Biology Exam#1...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online