08_Quiz_4_with_answers

08_Quiz_4_with_answers - ! 2 domain of the ! 70 protein. C...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
5' - CACTTTTCTGTAGTATTTGACCTAATTTCACTTAAGGAATATTATAGAACCAGA -3' 3' - GTGAAAAGACATCATAAACTGGATTAAAGTGAATTCCTTATAATATCTTGGTCT -5' A B C E D The nucleotide sequence shown below contains the elements of ! 70 promoters shown in boxes labeled A – E . Associate each of the statements provided under numbers 1 – 8 with the corresponding element (box) of such promoters. B 1. " 35 region. D 2. Binding site for the
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ! 2 domain of the ! 70 protein. C 3 . Binding site for the ! 3 domain of ! 70 . E 4. Potential transcription initiation sites. A 5. Binding site for the C-terminal domains of #-subunits ( # CTDs) of the RNA polymerase. D 6. " 10 region. A 7. UP region. B 8. Binding site for the ! 4 domain of ! 70 . MMG 431 -Quiz 4 October 1, 2008 W: 3.24 of 8 C: 2.57 of 8...
View Full Document

Ask a homework question - tutors are online