{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

08_Quiz_4_with_answers - 2 domain of the 70 protein C 3...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
5' - CACTTTTCTGTAGTATTTGACCTAATTTCACTTAAGGAATATTATAGAACCAGA - 3' 3' - GTGAAAAGACATCATAAACTGGATTAAAGTGAATTCCTTATAATATCTTGGTCT - 5' A B C E D The nucleotide sequence shown below contains the elements of ! 70 promoters shown in boxes labeled A – E . Associate each of the statements provided under numbers 1 – 8 with the corresponding element (box) of such promoters. B 1. " 35 region. D 2. Binding site for the
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ! 2 domain of the ! 70 protein. C 3 . Binding site for the ! 3 domain of ! 70 . E 4. Potential transcription initiation sites. A 5. Binding site for the C-terminal domains of #-subunits ( # CTDs) of the RNA polymerase. D 6. " 10 region. A 7. UP region. B 8. Binding site for the ! 4 domain of ! 70 . MMG 431 -Quiz 4 October 1, 2008 W: 3.24 of 8 C: 2.57 of 8...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern