Additional slides from lecture 210

Genetics: A Conceptual Approach

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 5’-ACGTTATAAA ACGTACGTACTACTGATCGGGGATTTACCATGG GACTTCAAGGTAAGT ATGAACGTACGCTCGGGACAGG GCCCTGACAGTAATAAA ACTGTCATTTCGGT-3’ 3’-TGCAATATTTTGCATGCATGATGACTAGCCCCTAAATGGTACCCTGAAGTTCCATTCA TACTTGCATGCGAGCCCTGTCCCGGGACTGTCATTATTTTGACAGTAAAGCCA-5’ TATA Box-25 Kozak Sequence* 5’ Splice Site* 3’ Splice Site* Poly(A) Consensus** a. Which strand is the template strand (top or bottom)? a. Which direction will RNA polymerase move along the DNA molecule shown (to the right or to the left)? a. Is this a bacterial gene or eukaryotic gene? a. What is the nucleotide sequence of the pre-mRNA? Draw a box around all exons. a. What is the nucleotide sequence of the mature mRNA? a. What is the amino acid sequence of the polypeptide encoded by the mature mRNA? You screen a genomic library and isolate a DNA fragment. You determine the nucleotide sequence of the fragment and then analyze it using a a software package that identifies known consensus sequences. The sequence of your DNA fragment and the location of consensus sequences is shown below: *consensus sequence active in RNA **assume cleavage occurs after 11 th nucleotide downstream … … 5’-ACGTTATAAA ACGTACGTACTACTGATCGGGGATTTACCATGG GACTTCAAGGTAAGT ATGAACGTACGCTCGGGACAGG GCCCTGACAGTAATAAA ACTGTCATTTCGGT-3’ 3’-TGCAATATTTTGCATGCATGATGACTAGCCCCTAAATGGTACCCTGAAGTTCCATTCA TACTTGCATGCGAGCCCTGTCCCGGGACTGTCATTATTTTGACAGTAAAGCCA-5’ TATA Box Kozak Sequence 5’ Splice Site 3’ Splice Site Poly(A) Consensus a. Which strand is the template strand (top or bottom)? Bottom strand is the template strand. TATA box consensus sequence (5’-TATAAA-3’) is located on the nontemplate strand. You screen a genomic library and isolate a DNA fragment. You determine the nucleotide sequence of the fragment and then analyze it using a a software package that identifies known consensus sequences. The sequence of your DNA fragment and the location of consensus sequences is shown below:-25 5’-ACGTTATAAA...
View Full Document

This note was uploaded on 05/06/2010 for the course BIO 311 taught by Professor Otto during the Spring '10 term at George Mason.

Page1 / 9

Additional slides from lecture 210 - 5’-ACGTTATAAA...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online