BIO 325 - Fall 2009 - TTh 930 to 1100 - Exam 2 - Key

BIO 325 - Fall 2009 - TTh 930 to 1100 - Exam 2 - Key -...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
GENETICS (BIO 325) Fall 2009 T, Th 9:30 – 11:00 AM section Key - Exam 2 __________________________________________________________________________________________________ 1. Parental DNA Heavy After one generation Intermediate Intermediate After two generations Intermediate Light Light Intermediate 2. 3. (a) Telomerases are composed of protein and RNA. They have an RNA-directed DNA polymerase activity
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
(b) ________________5’ ______________________TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 3’ Strand extended by telomerase after extension by telomerase 4. The oriC site is composed of five “9-mer” DnaA-binding sites (DnaA boxes) and three “13- mer” repeated elements (AT-rich region) that are the site of initial DNA unwinding. These two regions are critical for oriC function. 5. DNA is usually composed of two polynucleotide chains twisted around each other in the form of a double helix. In each polynucleotide chain, the nucleotides are joined to each other by a phosphodiester linkage creating a repeating sugar-phosphate backbone of the chain. The two polynucleotide chains are held together by base pairing in an antiparallel orientation. The pairing between adenine and thymine, and between guanine and cytosine, results in a complementary relationship between the sequence of bases on the two intertwined chains. DNA is usually a right-handed double helix. As a consequence of the helical nature of the
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 5

BIO 325 - Fall 2009 - TTh 930 to 1100 - Exam 2 - Key -...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online