BIOSTATISTICS1 - LINKAGE and QTL MAPPING BIOSTATISTICS 1...

Info iconThis preview shows pages 1–18. Sign up to view the full content.

View Full Document Right Arrow Icon
LINKAGE and QTL MAPPING BIOSTATISTICS 1 academic year 2009-2010
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Quantitative Trait Loci (QTL) mapping ± Detection of genomic regions that contribute to the variation in a quantitative trait . ± Detection by recombination mapping , also called linkage mapping . ± These genomic regions are stretches of DNA that are closely linked to the genes that underlie the trait in question ( QTL; quantitative trait loci ) ± Quantitative trait = a trait with a continuous phenotypic range. They are often polygenic , and may be influenced significantly by environmental effects ..
Background image of page 2
Quantitative variation e.g. root elongation rate in A. thaliana Db-2 Lz-0 NW108 Ty-0 Wt-4 TSU-1 Cvi-0 C24 Col-3 Nd-0 Kondona S96 Wei-0 Ler-1
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Quantitative variation e.g. colour coat in pigs
Background image of page 4
Quantitative variation e.g. tomato fruit size
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Quantitative variation e.g. butterfly wing patterns
Background image of page 6
Natural variation e.g. shape of human faces
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Key features of successful QTL mapping designs are: ± Ability to control the starting genetic variance –most designs start with two inbred parents that differ with respect to the trait of interest. ± Ability to reduce the environmental variance – in order to increase the proportion of overall phenotypic variance that is due to each QTL. ± Ability to increase the number of meioses as desired – recombination is allowed to break up linkage disequilibrium between markers over succeeding generations. ± Most flexible and most powerful in plants and nonhuman animals
Background image of page 8
Tools needed for QTL mapping ± Mapping population = set of segregants ± Tools to measure the phenotype of the segregants, e.g.: ± Tools to measure blood pressure or hart rate ± Microarrays to measure gene expression levels in segregants ± GC-MS / UPLC-MS to measure metabolites ± DNA markers to determine the genotype of the segregants at various genomic loci. ± Linkage map (results from genotyping the segregants)
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Principle of QTL mapping M 1 M 2 M 3 M 4
Background image of page 10
Relationship between controlled mapping crosses × BC 1:1 : AA, Aa P 1 :AA P 2 :aa × F 1 :Aa × F 2 : AA, Aa, aa BC 1:2 :Aa, aa x-1 generations RIL x : AA, aa
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
AFLP markers segregating in a RIL 8 mapping population P 1 P 2 1 2 3 4 5 . . .
Background image of page 12
SNP marker segregation in a F 2 mapping population P 1 Heterozygous P 2
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
SNP genotyping using HRM ± HRM is based on formation of homo- and heteroduplexes to separate the heterozygote from the homozygote (P 1 and P 2 ; WT and mutant) ± Principle: ± Amplification of the target sequence in the presence of fluorescent dye ± Denaturation and rapidly reannealing (for heterozygous DNA samples homoduplexes and heteroduplexes are formed) ± Slowly increase of the T: DNA begins to melt and heteroduplex DNA melts at a different T than homoduplex DNA ± Difference in T is detected
Background image of page 14
Physical versus linkage map ACGTACGTTAACGTAA TTCGCGCATGACGTAC GTTAACGTAATTCGCG CATGGGGggactggaatt ccgtgacgtgacgtgccgac tgaccgcatgagcgtagGC GCATGACGTACGTTAA CGTAATTCGCGCATGG GGGGACGTACGTACG TTAACGTAATTCGCCG CATGACGTGTTAACGT AATTCGCGCATGGGG GGACGTACGTACGCG CATGACGTACGTTAAC GTAATTCGCGCATGGG Gaacgtgacgtggacgtgc atgcggt Physical map Linkage or genetic map
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Typical representation of QTL mapping results LOD = log of the odds (see later)
Background image of page 16
A typical QTL map from a likelihood analysis Interpretation of a QTL result LOD = log of the odds (see later)
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 18
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 05/28/2010 for the course WE BIBI010000 taught by Professor Marnikvuylsteke during the Spring '10 term at Ghent University.

Page1 / 43

BIOSTATISTICS1 - LINKAGE and QTL MAPPING BIOSTATISTICS 1...

This preview shows document pages 1 - 18. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online