{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

BIOSTATISTICS1 - LINKAGE and QTL MAPPING BIOSTATISTICS 1...

Info icon This preview shows pages 1–18. Sign up to view the full content.

View Full Document Right Arrow Icon
LINKAGE and QTL MAPPING BIOSTATISTICS 1 academic year 2009-2010
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Quantitative Trait Loci (QTL) mapping Detection of genomic regions that contribute to the variation in a quantitative trait . Detection by recombination mapping , also called linkage mapping . These genomic regions are stretches of DNA that are closely linked to the genes that underlie the trait in question ( QTL; quantitative trait loci ) Quantitative trait = a trait with a continuous phenotypic range. They are often polygenic , and may be influenced significantly by environmental effects ..
Image of page 2
Quantitative variation e.g. root elongation rate in A. thaliana Db-2 Lz-0 NW108 Ty-0 Wt-4 TSU-1 Cvi-0 C24 Col-3 Nd-0 Kondona S96 Wei-0 Ler-1
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Quantitative variation e.g. colour coat in pigs
Image of page 4
Quantitative variation e.g. tomato fruit size
Image of page 5

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Quantitative variation e.g. butterfly wing patterns
Image of page 6
Natural variation e.g. shape of human faces
Image of page 7

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Key features of successful QTL mapping designs are: Ability to control the starting genetic variance – most designs start with two inbred parents that differ with respect to the trait of interest. Ability to reduce the environmental variance – in order to increase the proportion of overall phenotypic variance that is due to each QTL. Ability to increase the number of meioses as desired – recombination is allowed to break up linkage disequilibrium between markers over succeeding generations. Most flexible and most powerful in plants and nonhuman animals
Image of page 8
Tools needed for QTL mapping Mapping population = set of segregants Tools to measure the phenotype of the segregants, e.g.: Tools to measure blood pressure or hart rate Microarrays to measure gene expression levels in segregants GC-MS / UPLC-MS to measure metabolites DNA markers to determine the genotype of the segregants at various genomic loci. Linkage map (results from genotyping the segregants)
Image of page 9

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Principle of QTL mapping M 1 M 2 M 3 M 4
Image of page 10
Relationship between controlled mapping crosses × BC 1:1 : AA, Aa P 1 :AA P 2 :aa × F 1 :Aa × F 2 : AA, Aa, aa BC 1:2 :Aa, aa x-1 generations RIL x : AA, aa
Image of page 11

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
AFLP markers segregating in a RIL 8 mapping population P 1 P 2 1 2 3 4 5 . . .
Image of page 12
SNP marker segregation in a F 2 mapping population P 1 Heterozygous P 2
Image of page 13

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
SNP genotyping using HRM HRM is based on formation of homo- and heteroduplexes to separate the heterozygote from the homozygote (P 1 and P 2 ; WT and mutant) Principle: Amplification of the target sequence in the presence of fluorescent dye Denaturation and rapidly reannealing (for heterozygous DNA samples homoduplexes and heteroduplexes are formed) Slowly increase of the T: DNA begins to melt and heteroduplex DNA melts at a different T than homoduplex DNA Difference in T is detected
Image of page 14
Physical versus linkage map ACGTACGTTAACGTAA TTCGCGCATGACGTAC GTTAACGTAATTCGCG CATGGGGggactggaatt ccgtgacgtgacgtgccgac tgaccgcatgagcgtagGC GCATGACGTACGTTAA CGTAATTCGCGCATGG GGGGACGTACGTACG TTAACGTAATTCGCCG CATGACGTGTTAACGT AATTCGCGCATGGGG GGACGTACGTACGCG CATGACGTACGTTAAC GTAATTCGCGCATGGG Gaacgtgacgtggacgtgc atgcggt Physical map Linkage or genetic map
Image of page 15

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Typical representation of QTL mapping results LOD = log of the odds (see later)
Image of page 16
A typical QTL map from a likelihood analysis Interpretation of a QTL result LOD = log of the odds (see later)
Image of page 17

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 18
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern