lect 02 genome overview

lect 02 genome overview - Bioc 2808 Lecture 2 Overview of...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon
Click to edit Master subtitle style 7/29/10 Bioc 2808 Lecture 2 Overview of genome Instructor Dr. Junwen Wang
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
7/29/10 outlines Gene prediction Promoter prediction Motif finding microRNA prediction miRNA target prediction
Background image of page 2
7/29/10 From cell to DNA Cell : highly complex, multi- dimensional, functional system DNA : simple, linear structure Task : decode each piece of DNA
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
7/29/10 The Central Dogma of Molecular Biology
Background image of page 4
7/29/10 The Genes
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
7/29/10 GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAG ATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTT AGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATT AAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAA TATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAA GAAAAATATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATA AACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCT TACTCCTGCAAG AATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGA GAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACC ACTGTGGAAAACAGTACCGAGATTTCTTAA AGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCA
Background image of page 6
Image of page 7
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 07/29/2010 for the course BIOC BIOC2808 taught by Professor Dr.jjwang during the Fall '09 term at HKU.

Page1 / 23

lect 02 genome overview - Bioc 2808 Lecture 2 Overview of...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online