L18 - Transcription Translation Mutation

L18 - Transcription Translation Mutation - L18....

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: L18. Transcription, Translation, & Mutation DNA to RNA to proteins (gene products) The genetic code Mutations - small changes in the genetic code The frequency of mutations Chapter 17: 309-314, 344-346 Exam on Friday May 14. Will include material from Monday and Wednesday’s lectures. Start reviewing materials this week, not on Thursday night. 1 • The information content of DNA is in the form of specific sequences of nucleotides • The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins • Gene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation • Cells are governed by a cellular chain of command: DNA to RNA to proteins (correctly stated, gene products) 2 Overview: The Flow of Genetic Information TRANSCRIPTION DNA Prokaryotic cell 3 TRANSCRIPTION DNA mRNA Ribosom e Polypeptid e Prokaryotic cell Prokaryotic cell 4 The Genetic Code • How are the instructions for assembling amino acids into proteins encoded into DNA? • There are 20 amino acids, but there are only four nucleotide bases (A = adenine, C = cytosine, G = guanine, T = thymine) in DNA • So how many bases correspond to an amino acid? – 4 possible nucleotides x 4 x 4 = 64 “codes” 5 Gene 2 DNA molecule Gene 1 Gene 3 DNA strand (template) 3′ 5′ TRANSCRIPTION mRNA 5′ Codon 3′ TRANSLATION Gene Product Amino acid 6 Cracking the Code • All 64 codons were deciphered by the mid-1960s • The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid • 61 codons code for 20 amino acids (1 codon – start or methionine) • 3 stop codons 7 Fig. 17-5 First mRNA base (5′ end of codon) Second mRNA base Third mRNA base (3′ end of codon) Evolution of the Genetic Code • The genetic code is nearly universal, shared by the simplest bacteria to the most complex plants and animals • Genes can often be transcribed and translated after being transplanted from one species to another • E.g., use of bacteria to produce human proteins such as insulin 9 Fig. 17-6 (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene Introns - Noncoding Regions of DNA • Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions • These noncoding regions are called intervening sequences, or introns • The other regions are called exons because they are eventually expressed, usually translated into amino acid sequences 11 The Genetic Code - mRNA triplets and coded amino acids REDUNDANCY in the CODE is why there are silent mutations See Fig. 17.5 Serine coding via six redundant triplets or codons 12 Concept 17.5: Point mutations can affect protein structure and function • Mutations are changes in the genetic material of a cell or virus • Point mutations = chemical changes in just one base pair of a gene – Base pair substitution – Base pair insertion or deletion • The change of a single nucleotide in a DNA template strand can lead to the production of an abnormal protein 13 Base Pair Substitutions • A base-pair substitution replaces one nucleotide (and its partner) with a different nucleotide • Base-pair substitution can cause Silent, Missense, or Nonsense mutations • Silent mutations do NOT change the amino acid • Missense mutations still code for an amino acid, but not necessarily the right amino acid • Nonsense mutations change an amino acid codon into a stop codon, usually leading to a nonfunctional protein (unless near the end) • Missense mutations are more common 14 Fig. 17-23a Wild type 5′ 3′ 3′ Stop Carboxyl end A instead of G 3′ 5′ U instead of C 5′ Stop Silent (no effect on amino acid sequence) 15 DNA template 3′ strand 5′ mRNA 5′ Protein Amino end 5′ 3′ 3′ Fig. 17-23b Wild type 5′ 3′ 3′ Stop Carboxyl end T instead of C 3′ 5′ A instead of G 5′ Stop Missense 16 DNA template 3′ strand 5′ mRNA 5′ Protein Amino end 5 3′ 3′ Fig. 17-23c Wild type 5′ 3′ 3′ Stop Carboxyl end A instead of T 3′ 5′ U instead of A 5′ Stop Nonsense 17 DNA template 3′ strand 5′ mRNA 5′ Protein Amino end 5′ 3′ 3′ Impact of the changes in a single nucleotide and amino acid can be large Wild-type hemoglobin DNA 3′ 5′ 3′ Mutant hemoglobin DNA 5′ mRNA mRNA 5′ 3′ 5′ 3′ Normal hemoglobin Sickle-cell hemoglobin Fig. 17.22 18 A single nucleotide substitution in the Le gene causes a single amino acid change that reduces the production of a plant growth hormone tall dwarf 19 Indels: Second Type of Point Mutation (i.e. one base-pair) • Base-pair insertion or deletion – normally more disastrous than a base-pair substitution • Usually have a more disastrous effect on the resulting gene product compared with substitutions • Indel - Insertion or deletion of a nucleotide normally alters the reading frame, producing a frameshift mutation • This results in mostly missense amino acids and often, early termination (stop) 20 FIG. 17.25. INSERTIONS / DELETIONS (short ones) Frameshift Frameshift Mutation supplies the raw material for evolution Figure 17.25 21 Insertion or Deletion of Multiple Nucleotides • 3n nucleotide insertions or deletions typically have less impact than those that are not multiples of 3 (except insertion of an early stop) • Frameshift or nonsense mutations could have less impact if they occur near the end of the gene • A single missense (different amino acid) in some genes has little impact; other cases, large impact • Impact on the next generation progeny only if this occurs in gametes or cells giving rise to gametes 22 Fig. 17-10 5′ Exon Intron Exon Intron Exon 3′ Poly-A tail Pre-mRNA 5′ Cap 1 30 31 Coding segment mRNA 5′ Cap 1 5′ UTR 104 105 146 Introns cut out and exons spliced together Poly-A tail 146 3′ UTR HUMAN? Comparisons of the genomes of humans and chimpanzees are revealing those rare stretches of DNA that are ours alone By Katherine S. Pollard [FINDINGS] WHAT MAKES US Scientific American 2009 [E X PERIM ENT] makes a mobile messenger RNA copy and then uses the RNA as a template for synthesizing some needed protein. The labeling revealed that Efforts to uncover uniquely human DNA have yielded a number of sequences that are To nd the parts of our genome that make us human, the author wrote a computer proH AR1 is active in a type of neuron plays a distinctive in humans as compared with chimpanzees. A partial list of these sequences— thathuman genome for the pieces for DNA that have that have changed the most since humans and gram that searched of the DNA sequences ix years ago I jumped at an opportunity and some of their functions — follows below. key role in the pattern and layout of the develto join the international team that was changed thechimpanzees diverged from their last common ancestor. Topping the list was a 118-letter most since humans and chimps oping cerebral cortex, the wrinkled outermost nippet of code known Because identifyingU ENCE: H A R1 DNA bases, split from a scommon ancestor. as human most SEQ the sequence of Human brain layer. When things go wrong in these neuaccelerated region 1 (HAR1). This or “letters,” in the genomeAof the common chim- random genetic mutations neither bene t nor Common ancestor of What it does: ctive in the brain; region of the genome changed very rons, thenecessarymay be a severe, often deadly, result for humans and chimps may be panzee (Pan troglodytes). A s development a biostatistician harm an organism, they accumulate at a steady little for most of vertebrate evolucongenital disorderwhich is as lissencephaly of the cerebral cortex, known with a long-standing interest in human origins, rate that re tion, with chimp and of time that has ects the amount chicken seChimp 6 million especially large in humans. Possibly years ago (“smooth brain”), in which the cortex lacks its I was eager to also involved in sperm production. line up the human DNA sequence passed since quences differing by just two letters. two living species had a common KEY CONCEPTS characteristic folds and exhibits a markedly renext to that of our closest living relative and forebear (this uman of changeHAR1s, however, of million H rate and chimp is often spoken 300 duced surface area. Malfunctions in these same years ago Chimpanzees are the t ake stock. A humbling truth emerged: our as the “ticking of by 18 letters, suggesting that differ the molecular clock”). Accelclosest living relatives of neurons are also linked to the onset of schizoDNA blueprints areENCE: FOXP2 H rate of change in some new SEQU nearly 99 percent identical eration in thatAR1 acquired an importantpart of the humans and share nearly phrenia in adulthood. function in humans. to theirs. That is, of the three billion letters that genome, in contrast, is a hallmark of positive Common ancestor of What it does: Facilitates formation Chicken 9 9 percent of our DNA. humans and chickens H AR1 by the mouth, enablingthe right time and of words is thus active at make up the human genome, only 15 million of s election, in which mutations that help an modern human speech. place to be instrumental in the formation of a Efforts to identify those them— less than 1 percent— have changed in the organism survive and reproduce are more likely healthy cortex. (Other evidence suggests that it regions of the human TGAAACGG six million years or so since the human and to be passed on to future generations. In other A G G A G A C G T T A C g enome that have may additionally play a role in sperm producA codeC A haveC G -T G T C A G C T G A A A T chimp lineages diverged. words, those parts of the G that A under changed the most since tion.) ButENCE: AMY1 this piece of the genetic exactly how SEQU Evolutionary theory holds that the vast ma- gone the most modi cG A since the chimp- T A G A C G C A C G T C ation T G G G C G chimps and humans dicode affects cortex development is a mystery my AGCGGCGG jority of theseWhat it does: Facilitates digestion changes had little or no effect on human split are the sequences that most likely A A A T G G T T T C T A verged from a common colleagues and I are still trying to solve. We are of somewhere among those our biology. Butstarch, which may have enabled rough- shaped humankind. T C A A A A T G A A A G T G T T T A G A ancestor have helped pin early humans to exploit novel foods. eager to do so: HAR1’s recent burst of substituly 15 million bases lay the differences that made In November 2004, G A monthsT T C - T C A A G T T T C A after T T of debug C point the DNA sequences tions may have altered our brains signi cantly. us human. I was determined to nd them. Since ging and optimizing my program to run on a relative to that of the chimp that make us human. Changes in human sequence B eyond having a remarkable evolutionary then, I and others have made tantalizing prog- massive computer cluster at the University of T he ndings have also SEQUENCE:isASPM because it does not enhistory, HAR1 special ress in identifying a number of DNA sequences California, Santa Cruz,T Gally ended up with A G G A G A A A T T A C InAAATGG provided vital insights code a protein.CFor decades, molecular biology What it does: ontrols brain size, that set us apart from more than tripled over the chimps. a le that contained a ranked list of these rapid-T A T C A A C T G A A A T into how chimps and which has AGCAATT research focused almost exclusively on genes ly evolving sequences. With my mentor David course of human evolution. humans can differ so TATAGGTGTAGACACATGTC t blocks 24 An Earlyhat specify proteins, the basic buildingHaussler leaning over my shoulder, IGlooked at A A A T A G T T T C T A Surprise profoundly, despite AGCA TGG of cells. But thanks to the Human Genome Proj- DISTINCTIVE DNA SC ANNING THE GENOME S g 30,000 years ago. We present a draft sequence of the Neandertal billion nucleotides from three individuals. Comparisons of the s of five present-day humans from different parts of the world ons that may have been affected by positive selection in ancestral nvolved in metabolism and in cognitive and skeletal development. ore genetic variants with present-day humans in Eurasia than with n Africa, suggesting that gene flow from Neandertals into the before the divergence of Eurasian groups from each other. Janet Kelso, † Michael Lachmann, † David Reich, *† Svante Pääbo *† Neandertals, the closest evolutionary relatives of present-day humans, lived in large parts of Europe 7 MAY 2010 VOL 328 SCIENCE www.sciencemag.org and western Asia before disappearing 30,000 years ago. We present a draft sequence of the Neandertal genome composed of more than 4 billion nucleotides from three individuals. Comparisons of the Neandertal genome to the genomes of five present-day humans from different parts of the world 2 identify a number of genomic regions that may have been affected by positive5selection in ancestral modern humans, including genes involved in metabolism and in cognitive and skeletal development. rg on May 9, 2010 Hernán A. Burbano, † Jeffrey M. even if gene iverged from within present-day humans. Thus,Good, no † Rigo Schultz, Ayinuer Aximu-Petri, Anne Butthof, Barbaraflow occurred, in many segments of the genome,Siegemund,1 Antje Weihmann,1 Chad Nusbaum,2 Höber,1 Barbara Höffner,1 Madlen *To whom correspondence should be addressed. E-mail: [email protected] (R.E.G.); [email protected] s the question Neandertals are expected to be more closely re- edu 2 Eric S. Lander,2 Carsten Russ,2 Nathaniel Novod, (D.R.); [email protected](S.P.) Jason Affourtit, Michael Egholm,9 than with anatomi- lated to some present-day humans 10 they are to †Members11 the Neandertal Genome Analysis Consortium. 10 of Christine Verna,21 Pavao Rudan, Dejana Brajkovic, Željko Kucan,10 Ivan Gušic, gical features each other (20). However, if Neandertals are, on ‡Present address: Department of Biomolecular Engineer12 13 14 Vladimir B. Doronichev,12 Liubov regions of the ing, Carles California, Santa Cruz, Marco USA. anatomically average across many independent V. Golovanova, University of Lalueza-Fox, CA 95064,de la Rasilla, §These authors contributed equally to this 18 work. 14 more closely related to present-day hu15 16,17 7 interpreted as Fortea, ¶ Antonio Rosas, Ralf W. Schmitz, Javier genome, Philip L. Institute of Genomics, Chinese ||Present address: BeijingF. Johnson, † Evan E. Eichler, † certain parts of the world than in others, Academy of Sciences Beijing 100029, P.R. China. 4 5 st (10, 11) ge- mans in19 Daniel Falush, † Ewan Birney, † James C. Mullikin, † Montgomery Slatkin,3† Rasmus Nielsen,3† ls and the pre- this would strongly suggest that Neandertals ex- ¶Deceased. 1 1 2,20 1 1 Department of Evolutionary Genetics, Max-Planck Institute for Evolutionary Anthropology, D-04103 Leipzig, Germany. 2Broad pical of Nean- sumed ancestors of present-day Europeans. Institute of MIT and Harvard, Cambridge, MA 02142, USA. uropean fossil Similarly, analysis of DNA sequence data from 3Department of Integrative Biology, University of California, rs ago (1–3). present-day humans has been interpreted as evi- Berkeley, CA 94720, USA. 4European Molecular Biology ndertal forms dence both for (12, 13) and against (14) a genetic Laboratory–European Bioinformatics Institute, Wellcome Trust Genome dertals disap- contribution by Neandertals to present-day hu- 5Genome Campus, Hinxton, Cambridgeshire, CB10 1SD, UK. Technology Branch, National Human Genome Ret 30,000 years mans. The only part of the genome that has been search Institute, National Institutes of Health, Bethesda, MD their history, examined from multiple Neandertals, the mito- 20892, USA. 6Program in Bioinformatics and Integrative Biology, Massachusetts Medical School, Worcester, MA Western Asia chondrial DNA (mtDNA) genome, consistently University of 7 5) and as far falls outside the variation found in present-day 01655, USA. Howard Hughes Medical Institute, Department of Genome Sciences, University of Washington, Seattle, WA at time, Nean- humans and thus provides no evidence for inter- 98195, USA. 8Division of Biological Sciences, University of tact with ana- breeding (15–19). However, this observation Montana, Missoula, MT 59812, USA. 9454 Life Sciences, 10 ddle East from does not preclude some amount of interbreeding Branford, CT 06405, USA. Croatian Academy of Sciences and Arts, Zrinski trg 11, HR-10000 Zagreb, Croatia. 11Croatian subsequently (14, 19) or the possibility that Neandertals conAcademy of Sciences and Arts, Institute for Quaternary tributed other parts of their genomes to present- Paleontology and Geology, Ante Kovacica 5, HR-10000 Zagreb, of all present- day humans (16). In contrast, the nuclear genome Croatia. 12ANO Laboratory of Prehistory, St. Petersburg, Russia. of the human is composed of tens of thousands of recombin- 13Institute of Evolutionary Biology (UPF-CSIC), Dr. Aiguader 14 ndertals and ing, and hence independently evolving, DNA seg- 88, 08003 Barcelona, Spain. Área de Prehistoria Departamento de Historia Universidad de Oviedo, Oviedo, Spain. anatomically ments that provide an opportunity to obtain a 15Departamento de Paleobiología, Museo Nacional de Ciencias ominin forms clearer picture of the relationship between Nean- Naturales, CSIC, Madrid, Spain. 16Der Landschaftverband Rheinlund–Landesmuseum Bonn, Bachstrasse 5-9, D-53115 eandertal ge- dertals and present-day humans. Richard E. A challenge †‡detecting signals of gene1flow Adrian W. Briggs,1†für Vor- und Frühgeschichtliche 1†§ Green,1* in Johannes Krause, †§ Bonn, Germany. 17Abteilung § Tomislav Maricic, g of changes 18 Department of Archäologie, Universität Bonn, risen to high between†Neandertals and modern †§ Nick Patterson,Emory University, Atlanta,†Germany. USA. 19Department|| Udo Stenzel,1 § Martin Kircher,1 human ances- Biology, 2†§ Heng Li,2 GAWeiwei Zhai,3† 30322, ring the last tors is that the two groups share common ances- of Microbiology, University3College Cork, Cork, Ireland. 20Depart4 5 Markus Hsi-Yang Fritz, † Nancy F. Hansen, † Eric Y. Durand, † Anna-Sapfo Malaspinas,3† d should be tors within the last 500,000 years, which is no ment of Genetics, Harvard Medical School, Boston, MA 02115, 7 1 1 Jeffrey deeper than 6† Tomas Marques-Bonet,7,13 USA. 21Department of Human Evolution, Max-Planck Institute s affected by D. Jensen,the nuclear DNA sequence variation † Can Alkan, † Kay Prüfer, † Matthias Meyer, † 1 1,8 1 1 1 for Evolutionary Anthropology, D-04103 Leipzig, Germany. Using genomics to study our closest relative Even though parts of their genome with the anceschanged they are extinct! tors of these groups. Several features of DNA extracted from Late Pleistocene remains make its study challenging. The DNA is invariably degraded to a small average size of less than 200 base pairs (bp) (21, 22), it is chemically modified (21, 23–26), and extracts almost always contain only small amounts of endogenous DNA but large amounts of DNA from microbial organisms that colonized the specimens after death. Over the past 20 years, methods for ancient DNA retrieval have been developed (21, 22), largely based on the polymerase chain reaction (PCR) (27). In the case of the nuclear genome of Neandertals, four short gene sequences have been determined by PCR: fragments of the MC1R gene involved in skin pigmentation (28), a segment of the FOXP2 gene involved in speech and language (29), parts of the ABO blood group locus (30), and a taste receptor gene (31). However, although PCR of ancient DNA can be multiplexed (32), it does not allow the retrieval of a large proportion of the genome of an organism. The development of high-throughput DNA sequencing technologies (33, 34) allows large-scale, genome-wide sequencing of random pieces of not allow the retrieval of a large proportion of the genome of an organism. The development of high-throughput DNA sequencing technologies (33, 34) allows large-scale, genome-wide sequencing of random pieces of DNA extracted from ancient specimens (35–37) and has recently made it feasible to sequence ge- RESEARCH ARTICLE A Draft Sequence of the Neandertal Genome Identify regions that changed in humans relative to Neandertals 26 One gene of interest found in the study (among many!) • A gene RUNX2 shows several changes only in human lineage that is important for cranial development “A reasonable hypothesis is thus that an evolutionary change in RUNX2 was of importance in the origin of modern humans and that this change affected aspects of the morphology of the upper body and cranium.” Green et al 2010 27 A B Neandertal’s have the C Modern Humans have the U (T) hsa-miR-1304 C!U 0 1 0 1 Base-pair probability Base-pair probability hsa-mir-1304 AC109351.3 !"#$%&' ()*+! $%&'()*! +,--./001234-56472686943:43-0:;6<5620$%&'()*4:;6=! (7-.7-! '(1! -,9! ->(!?6:1($%&@!@,(>62;!-,9!32:9@-13)!@-3-9! 62!%932*91-3)!>,6)9! 5962;!'6A9*!*91689*! 62! ?(*912! ,7?32@! >6-,! 19@.9:-! -(! *5B%C4! D(1! ,@3<?61<EF#G! +&=! -,9! 32:9@-13)! :H-(@629! 6@! ([email protected]*! 62! %932*91-3)! >,6)9! ?(*912! ,7?32@! 319! '6A9*! *91689*! '(1! -,H?629!+713:6)!62!-,9!?6:1($%&!-132@:16.-=4!I,9!:,32;9!6@!)(:3-9*!62!-,[email protected]*!('!-,9! 28 ?3-719!?6:1($%&J!-,7@!6-!)6K9)H!-(!3)-91!-31;9-!@.9:6'6:6-H!([email protected](2!.19@92-! 100% 90% Insertion / deletions (InDels) 20% Human Neandertal Outgroups 10% 100% 0% Unknown Unknown Other Ancestral 100% Other Derived Ancestral (fixed) Ancestral (variable) 90% Derived 80% 90% Changes on human lineage 30% 20% Single nucleotide changes (SNC) 20% 10% 10% 0% 0% InDels SNC CCDS 3' UTR 5' UTR Coding ! !"#$%&'()*+'$%&'()!&*+(),-%.)!+/0&')1!2$345!0&.!%&1)6-%,&7.)()-%,&!+/0&')1!28&9)(15! ,&!-/)!/*:0&!(%&)0')!%&;)66).!;6,:!</,()!')&,:)!0(%'&:)&-1!0&.!-/)%6!1-0-)!,=-0%&).! ;6,:!-/)!:%&%+,&-%'1!+6)0-).!;6,:!0((!>[email protected]!>[email protected]!0&.!>[email protected]!6)0.1@! 29 Mutagens • Spontaneous mutations can occur during DNA replication, recombination, or repair • Mutagens are physical or chemical agents that can cause mutations • X-rays used to generate Drosophila mutants in the 1920s; UV light (skin cancer) • Carcinogens (cancer causing) agents are often mutagens and vice versa (so mutagenicity may predict carcinogenicity) 30 MUTATION (frequency and effects) • In humans, most mutations occur in noncoding sections of DNA and are single base pair substitutions or small insertions and deletions of base pairs • Mutation is the ultimate source of genetic variation, but is random relative to the needs of the organism Mutation is rare: ~0.1 - 2 phenotypically detectable mutations per human Most phenotypically detectable mutations are deleterious. • • 31 MUTATION (frequency) E. coli mutation rate = 1 x 10-7 mutations / gene / cell division 2 x 1010 new cells / day / colon ~ 4,300 genes (4.6 million nucleotide pairs) ~ 9 million mutations / day / colon ! 32 Mutation (frequency and causes) “Bone Cabin” ENVIRONMENT can influence mutation rates 33 Practice Question 2 In Mendel’s studies, the allele for round seed was dominant over that for wrinkled seed and the unlinked allele for yellow seed was dominant over green seed. What offspring are produced by a dihybrid cross of a wrinkled green seed by the double heterozygous genotype? Answer: 4 round-yellow, 4 round-green, 4 wrinkledyellow, and 4 wrinkled-green seeds 34 Outline for Studying for Midterm 2 Ch. 14 - Mendel’s Garden Peas (2 lectures) Understand monohybrid vs. dihybrid crosses Be able to translate the phenotype of the parent into its genotype, determine what gametes are produced and predict F2 progeny based on a Punnett square; translate F2 genotypes to F2 phenotypes Incomplete dominance, codominance, pleiotropy, epistasis, polygenic inheritance, environmental impact on phenotype, human genetics & disease 35 Outline for Studying for Midterm 2 (cont.) Ch. 15 - Chromosomes, Inheritance, & Mutation How do Mendel’s Laws of Segregation and Independent Assortment translate to what we now know about chromosomes? Sex determination; X inactivation Sex-linked inheritance and disorders Aneuploidy (Down syndrome) vs. Polyploidy Mutations in large parts of a chromosome Ch. 17 - Genes to Proteins, Mutation The genetic code -- impacts of changes (mutations) Point mutations - silent, nonsense, missense Impact of various base-pair insertions and deletions Mutagens 36 ...
View Full Document

This note was uploaded on 08/15/2010 for the course BIO 5c taught by Professor Zhu/cardullo/rao during the Spring '08 term at UC Riverside.

Ask a homework question - tutors are online