exam II- answer key

exam II- answer key - Your Name Exam 2 BIO 325 Genetics Mar...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Your Name: 1 Exam 2. BIO 325 Genetics – Mar. 13, 2009 1-7 ; Fill the blank with word(s). (2 points ea.; no partial score) 1. A(n) ____ Genome _______ is the entire collection of chromosomes in an organism. 2. A(n) ___ Physical ______ map is a constellation of overlapping DNA fragments that are ordered and oriented and span each of the chromosomes in a given genome. 3. Different combinations of alleles at multiple loci that result in measurable differences in phenotype are known as _ Quantitative _____ ___ Trait ______ loci. 4. Bacteria can exchange genetic information between different strains through _ Transformation _, Conjugation _, and transduction _. 5. _ Chromatin __ is the generic term for any complex of DNA and protein found in a cell's nucleus. 6. The DNA running both ways from one origin of replication to the endpoints where it merges with DNA from adjoining replication forks is called a replication unit, or __ replicon ____. 7. In the 1970s, Lynn Margulis and others proposed that today's chloroplasts and mitochondria descended from prokaryotic ancestors in a theory called the _ Endosymbiont ___ ___ Theor ____. 8 – 11. True or False; Circle one ( 1 pt ea.) 8. Heterochromatic DNA is DNA that is actively transcribed. True False 9. If DNA is isolated from two healthy individuals, it is very likely that their DNA sequence will be identical. True False 10. The universal code of DNA also applies to mtDNA but not to cpDNA. True False 11. DNA fingerprints identify polymorphisms in microsatellites and can be used to identify family relationships between old skeletal material and living individuals. True False
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Your Name: 2 Multiple choice questions may have 1 ~ 5 correct answers. You should CIRCLE all correct answer(s) to be scored (no partial score); (3 pts ea.) 12. Which of the following statements are true of DNA arrays? A. Oligonucleotide array uses already synthesized oligonucleotides, which are spotted on the slide. B. Affymetrix array uses already synthesized oligonucleotides to construct DNA array on the slide. C. Nimblegen array uses photo-activating building blocks to construct DNA array on the slide. D. DNA arrays can be used to detect levels of mRNA expression. E. None. All of them are correct. 13. In the course of sequencing a genome, shotgun sequencing of small DNA fragments resulted in following sequences. How many contigs are represented by this set of DNA sequences? 5’ CAAAAAGCAGCAAATTACAG 3’ 5’ CAATATGAAGAGATCATACA 3’ 5’ TGATCTCTTCATATTGCTGTA 3’ 5’ TTACAGCAATATGAAGATCA 3’ 5’ CTGTAATTTGCTGCTTTTTGAA 3’ A. 1 B. 2 C. 3 D. 4 E. 5 14. Which of the following methods use DNA ligase? A. DNA array. B. SOLiD sequencing.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 8

exam II- answer key - Your Name Exam 2 BIO 325 Genetics Mar...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online