EX3DNA_ANSWERS

EX3DNA_ANSWERS - Anthropology 12: Exercise 3 Due March 1,...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Anthropology 12: Exercise 3 Name______________________________ Due March 1, 2010 Section 1. (3 pts) Read pages 46-51 To help answer the following question. You may also want to go to http://learn.genetics.utah.edu/content/begin/dna/ and go through the tutorials there which are really good. Try the transcription/translation exercise ( http://learn.genetics.utah.edu/content/begin/dna/transcribe/ ) before you do this one Given the following DNA sequence: AAGTCATGATTACCCTGATATACGGGAAGCTTGAAATAAACGAATTAG How many amino acids does this sequence of DNA code for? ____ 16 _____ What are the tRNA anticodons for this sequence of DNA? AAG UCA UGA UUA CCC UGA UAU ACG GGA AGC UUG AAA UAA ACG AAU UAG Briefly describe the process by which this sequence of DNA will make a protein. TRANSCRIPTION: dna unzips and mrna copies in the complement. Mrna then travels to cytoplasm TRANSLATION: Ribosome works to match up mrna codons with trna anticodons. Trna drop off the amino acids that they are carrying to be built
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 09/08/2010 for the course ANTH 12 at San Jose State.

Page1 / 2

EX3DNA_ANSWERS - Anthropology 12: Exercise 3 Due March 1,...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online