EX3DNA_ANSWERS - Anthropology 12 Exercise 3 Due March 1...

Info icon This preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Anthropology 12: Exercise 3 Name______________________________ Due March 1, 2010 Section 1. (3 pts) Read pages 46-51 To help answer the following question. You may also want to go to http://learn.genetics.utah.edu/content/begin/dna/ and go through the tutorials there which are really good. Try the transcription/translation exercise ( http://learn.genetics.utah.edu/content/begin/dna/transcribe/ ) before you do this one Given the following DNA sequence: AAGTCATGATTACCCTGATATACGGGAAGCTTGAAATAAACGAATTAG How many amino acids does this sequence of DNA code for? ____ 16 _____ What are the tRNA anticodons for this sequence of DNA? AAG UCA UGA UUA CCC UGA UAU ACG GGA AGC UUG AAA UAA ACG AAU UAG Briefly describe the process by which this sequence of DNA will make a protein. TRANSCRIPTION: dna unzips and mrna copies in the complement. Mrna then travels to cytoplasm TRANSLATION: Ribosome works to match up mrna codons with trna anticodons. Trna drop off the amino acids that they are carrying to be built into a polypeptide chain.
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern