EX3DNA - Will this new mutation create a new phenotype?...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Anthropology 12: Exercise 3 Name______________________________ Due March 1, 2010 Section 1. (3 pts) Read pages 46-51 To help answer the following question. You may also want to go to http://learn.genetics.utah.edu/content/begin/dna/ and go through the tutorials there which are really good. Try the transcription/translation exercise ( http://learn.genetics.utah.edu/content/begin/dna/transcribe/ ) before you do this one Given the following DNA sequence: AAGTCATGATTACCCTGATATACGGGAAGCTTGAAATAAACGAATTAG How many amino acids does this sequence of DNA code for? _________ What are the tRNA anticodons for this sequence of DNA? Briefly describe the process by which this sequence of DNA will make a protein. 2. (2 pts) A new mutation has occurred in the creation of a gamete.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Will this new mutation create a new phenotype? Explain the possible results of this new mutation on the phenotype. 3. (3 pts) Diagram meiosis using a cell with four chromosomes in two homologous pairs. What happens at each stage? How can the process vary? 4. (2 pts) One of the DNA related issues mentioned in the text is cloning. Write a paragraph or more about cloning, answering the following questions: How is cloning different from sexual reproduction at the level of DNA and genes? Why is it that cloning the same individual would not produce two identical adults? Why would you expect these adult clones to be different from one another?...
View Full Document

This note was uploaded on 09/08/2010 for the course ANTH 12 at San Jose State.

Page1 / 2

EX3DNA - Will this new mutation create a new phenotype?...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online