{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Quiz-4-Key - Quiz 4 F09 BIO315H U F F L L L L L L I I I M V...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
U C A G F S Y C U U F S Y C C L S Stop Stop A L S Stop W G L P H R U C L P H R C L P Q R A L P Q R G I T N S U A I T N S C I T K R A M T K R G V A D G U G V A D G C V A E G A V A E G G The DNA molecule below codes for a short protein signal molecule with no introns. From the sequence below write sequence of the expected mRNA and then the complete protein sequence that you would expect ribosomes to produce in a cell: 5 ʼ - GGGCTAATAATTCGCTTCCATCGCGGAAATATCCATTTATTC -3
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}