Quiz-4-Key - Quiz 4 F09! BIO315H U F F L L L L L L I I I M...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Quiz 4 F09! BIO315H U F F L L L L L L I I I M V V V V C S S S S P P P P T T T T A A A A A Y Y Stop Stop H H Q Q N N K K D D E E G C C Stop W R R R R S S R R G G G G U C A G U C A G U C A G U C A G U C A G The DNA molecule below codes for a short protein signal molecule with no introns. From the sequence below write sequence of the expected mRNA and then the complete protein sequence that you would expect ribosomes to produce in a cell: 5ʼ- GGGCTAATAATTCGCTTCCATCGCGGAAATATCCATTTATTC -3 ʼ 3ʼ- CCCGATTATTAAGCGAAGGTAGCGCCTTTATAGGTAAATAAG -5ʼ mRNA: 5ʼ-__AUG GAU AUU UCC GCG AUG GAA GCG AAU UAU UAG____ -3ʼ Protein: N-___M___D___I____S____A___M___E___A___N___Y___________ -C ...
View Full Document

This note was uploaded on 09/12/2010 for the course BIO 325H taught by Professor Staff during the Spring '08 term at University of Texas at Austin.

Ask a homework question - tutors are online