Bio172-E1-W08-SA - These vesicles are 50-90 nm in diameter....

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Exam 1 short answer questions Winter 2008 32) Below is a sequence of RNA. Please draw a likely secondary structure showing each base. 5’- AGACGCUAAGGGCAUGAACUGAUUGGCAUGCCCUUCAUGGA – 3’ 33) Many newly synthesized proteins travel through the Golgi via small vesicles that bud and fuse from the Golgi cisternae.
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: These vesicles are 50-90 nm in diameter. Collagen forms very stiff, stable rods of 150 nm in length in the cis Golgi and clearly moves through the Golgi from the cis to the trans cisternae. How do you think this movement occurs?...
View Full Document

This note was uploaded on 09/13/2010 for the course BIO 172 taught by Professor Clark during the Spring '08 term at University of Michigan.

Ask a homework question - tutors are online