Day_3_-_transcription_and_RNA_Processing

Day_3_-_transcription_and_RNA_Processing - Transcription...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Transcription and RNA Processing The Central Dogma For the phenotypic expression of any gene, information contained in DNA is first transcribed into an RNA from where it is translated into the amino-acid sequence of the corresponding protein. Phenotypes are the manifestation of the activity/function of proteins and catalytic RNAs. DNA RNA Transcription RNA Pol + factors Protein Translation Ribosomes, tRNA aa + other factors Function Enzyme, structural element, hormone, regulatory, etc The assumptions of the central dogma are sound, but there are exceptions! Phenotype The Revised Central Dogma DNA REVERSE TRANSCRIPTION Ribozymes FUNCTION FUNCTION Interactions Exceptions to the Central Dogma 1. Information contained in RNA can be copied into DNA by reverse transcriptases and telomerase . EXAMPLES: retroviruses, mobile introns. 2. After transcription, nucleotides can be added to, deleted from, or modified in some mRNAs by processes known as RNA editing . EXAMPLES: addition and deletion of Us in the mitochondria of trypanosomes, conversion of Cs to Us in plant mitochondria by deamination. 3. Not all genes are expressed phenotypically through proteins. EXAMPLES: the RNAs of mobile introns are nucleases, the LSU ribosomal RNA has peptide synthetase activity. Such RNAs are classified as ribozymes . Ribozymes favor the concept that a more primitive RNA-based ancestral form of life may have preceded the DNA-, RNA-, protein-based life as we know it now. The first step of the expression of a gene (DNA) is to transcribe the information contained in the nucleotide sequence from one strand (template or antisense strand) into an RNA. The product of this transaction is a transcript . If a gene carries information for the assembly of a protein, the transcript is a messenger RNA ( mRNA ). The information in mRNAs is decoded by ribosomes and translated by alignment of three-nucleotide codons with corresponding tRNAs that deliver the corresponding amino acids. Transcription Translation The messenger: a general view of transcription and translation U U U U U Coding strand of DNA Template strand of DNA mRNA 5 3 Transcription and RNA Processing Topics 1. RNA structure. 2. RNA synthesis. 3. Transcription: initiation, elongation and termination. 4. RNA processing: cleavage of precursor transcripts and modification of bases. 5. RNA and protein splicing. 6. RNA editing. Videos Ribonucleoside triphosphate O Base RNA precursors Fig. 2.1 RNA polynucleotide chain 5 3 RNA Structure Secondary structure: regions of base pairing (double-stranded helical regions) Stem-loop Fig 2.2 Primary structure: order of the nucleotides read 5 3 5 ACUCAUCGGCACGUCAUGCUGAUAUCCGGCUUGACACU 3 Tertiary structure: folding of the entire RNA chain Pseudoknot Only non-covalent hydrogen bonding is involved in secondary and tertiary structure formation Tertiary structure of a transfer RNA 5 3 Structure of E. coli 16S rRNA 1. ~1500 nucleotides long 2. Compact 3-D folding 3. Highly conserved 5 3 Kinds of RNA found in a typical bacterium (E. coli )Kinds of RNA found in a typical bacterium (E....
View Full Document

Page1 / 50

Day_3_-_transcription_and_RNA_Processing - Transcription...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online