MIT6_047f08_lec02_slide02

MIT6_047f08_lec02_slide02 - MIT OpenCourseWare...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms .
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Sequence Alignment and Dynamic Programming 6.047/6.878 - Computational Biology: Genomes, Networks, Evolution Tue Sept 9, 2008
Background image of page 2
DNA Genome Assembly Database lookup Gene expression analysis Cluster discovery Gibbs sampling Protein network analysis Emerging network properties Regulatory network inference Challenges in Computational Biology 1 Gene Finding 5 Regulatory motif discovery 3 Sequence alignment Evolutionary Theory 7 T C ATG C TAT T CG TGATA A TGA G GATAT T T AT C ATAT T T ATGAT T T Comparative Genomics 6 2 4 8 RNA transcript 9 10 11 13 12
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Reminder: Last lecture / recitation Schedule for the term – ‘Foundations’ till midterm – ‘Frontiers’ lead to final project – Duality: basic problems / fundamental techniques Biology introduction – DNA, RNA, protein, transcription, translation – Why computational biology Today: Comparative genomics is everywhere! – Problem set 1: dating vertebrate whole-genome duplication – Problem set 2: discover genes using their conservation properties – Problem set 3: discover all motifs across entire yeast genome – Problem set 4: reversing human/mouse genome rearrangements
Background image of page 4
Evolution preserved functional elements! Scer TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACA Spar CTATGTTGATCTTTTCAGAATTTTT-CACTATATTAAGATGGGTGCAAAGAAGTGTGATTATTATATTACATCGCTTTCCTATCATACACA Smik GTATATTGAATTTTTCAGTTTTTTTTCACTATCTTCAAGGTTATGTAAAAAA-TGTCAAGATAATATTACATTTCGTTACTATCATACACA Sbay TTTTTTTGATTTCTTTAGTTTTCTTTCTTTAACTTCAAAATTATAAAAGAAAGTGTAGTCACATCATGCTATCT-GTCACTATCACATATA * * **** * * * ** ** * * ** ** ** * * * ** ** * * * ** * * * Scer TATCCATATCTAATCTTACTTATATGTTGT-GGAAAT-GTAAAGAGCCCCATTATCTTAGCCTAAAAAAACC--TTCTCTTTGGAACTTTCAGTAATACG Spar TATCCATATCTAGTCTTACTTATATGTTGT-GAGAGT-GTTGATAACCCCAGTATCTTAACCCAAGAAAGCC--TT-TCTATGAAACTTGAACTG-TACG Smik TACCGATGTCTAGTCTTACTTATATGTTAC-GGGAATTGTTGGTAATCCCAGTCTCCCAGATCAAAAAAGGT--CTTTCTATGGAGCTTTG-CTA-TATG Sbay TAGATATTTCTGATCTTTCTTATATATTATAGAGAGATGCCAATAAACGTGCTACCTCGAACAAAAGAAGGGGATTTTCTGTAGGGCTTTCCCTATTTTG ** ** *** **** ******* ** * * * * * * * ** ** * *** * *** * * * Scer CTTAACTGCTCATTGC-----TATATTGAAGTA CGG ATTAGAAGCCG CCG AG CGG GCGACAGCCCT CCG A CGG AAGACTCTCCT CCG TGCGTCCTCGTCT Spar CTAAACTGCTCATTGC-----AATATTGAAGTA CGG ATCAGAAGCCG CCG AG CGG ACGACAGCCCT CCG A CGG AATATTCCCCT CCG TGCGTCGCCGTCT Smik TTTAGCTGTTCAAG--------ATATTGAAATA CGG ATGAGAAGCCG CCG AA CGG ACGACAATTCC CCG A CGG AACATTCTCCT CCG CGCGGCGTCCTCT Sbay TCTTATTGTCCATTACTTCGCAATGTTGAAATA CGG ATCAGAAGCTG CCG AC CGG ATGACAGTACT CCG G CGG AAAACTGTCCT CCG TGCGAAGTCGTCT ** ** ** ***** ******* ****** ***** *** **** * *** ***** * * ****** *** * *** Scer TCACCGG-TCGCGTTCCTGAAACGCAGATGTGCCT CGC GCCGCACTGCT CCG AACAATAAAGATTCTACAA-----TACTAGCTTTT--ATGGTTATGAA Spar TCGTCGGGTTGTGTCCCTTAA-CATCGATGTACCT CGC GCCGCCCTGCT CCG AACAATAAGGATTCTACAAGAAA-TACTTGTTTTTTTATGGTTATGAC Smik ACGTTGG-TCGCGTCCCTGAA-CATAGGTACGGCT CGC ACCACCGTGGT CCG AACTATAATACTGGCATAAAGAGGTACTAATTTCT--ACGGTGATGCC Sbay GTG-CGGATCACGTCCCTGAT-TACTGAAGCGTCT CGC CCCGCCATACC CCG
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 6
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 09/24/2010 for the course EECS 6.047 / 6. taught by Professor Manoliskellis during the Fall '08 term at MIT.

Page1 / 48

MIT6_047f08_lec02_slide02 - MIT OpenCourseWare...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online