MCDB_1A_Midterm_1_2009

MCDB_1A_Midterm_1_2009 - Name TA MCDB 1A Midterm...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Name _________________________ TA ________________________ MCDB 1A Midterm Examination I October 20, 2009 Scantron Instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles. 4. Write the color of your test in the space underneath the ID number box. 5. Fill in the entire rectangle of the answer you choose. If you erase, erase completely READ ALL QUESTIONS THOROUGHLY----IN ALL CASES, PICK THE BEST ANSWER 33 QUESTIONS - 3 POINTS EACH TEST COLOR - 1 POINT Metabolic Tables and Genetic Code are Attached to Back of Exam Use the following mRNA to answer the next 2 questions 5' UUACCGAUACGAUGCUUAGUUUUACGGUAUAACGAGCAG 3' 1. What will be the fourth amino acid? A. Serine B. Phenylalanine C. Arginine D. Tyrosine E. Some other amino acid 2. How many amino acids will be in the protein synthesized by this mRNA? 3. Imagine that you were examining the fatty acid composition of the phospholipids in the membranes of a cold blooded organism. You note that during the day, the fatty acid chains are longer and more unsaturated than during the night. What would be the best explanation for these observations? A. the organism is responding to changing temperature and trying to maintain membrane fluidity B. the organism is responding to the change in the light-dark cycle and trying to maintain membrane fluidity C. the organism eats during the day, so it has more cholesterol available with which to regulate phospholipid composition. D. the organism eats during the day, so there are better fatty acids available to incorporate into the membrane MCDB 1A Midterm 1 Pink (1) Version: 1 Page: 1
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
4. In the famous Hershey-Chase experiment that used radioactively labeled bacteriophage T2 and a blender, what is the most rigorous interpretation of the observation that S35 was found primarily in the supernatent rather than the pellet? 5. Is this the correct chemistry for peptide bond formation? A. Yes B. No
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern