MCDB_1A_Midterm_1_2009

MCDB_1A_Midterm_1_2009 - Name _________________________ TA

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Name _________________________ TA ________________________ MCDB 1A Midterm Examination I October 20, 2009 Scantron Instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles. 4. Write the color of your test in the space underneath the ID number box. 5. Fill in the entire rectangle of the answer you choose. If you erase, erase completely READ ALL QUESTIONS THOROUGHLY----IN ALL CASES, PICK THE BEST ANSWER 33 QUESTIONS - 3 POINTS EACH TEST COLOR - 1 POINT Metabolic Tables and Genetic Code are Attached to Back of Exam Use the following mRNA to answer the next 2 questions 5' UUACCGAUACGAUGCUUAGUUUUACGGUAUAACGAGCAG 3' 1. What will be the fourth amino acid? A. Serine B. Phenylalanine C. Arginine D. Tyrosine E. Some other amino acid 2. How many amino acids will be in the protein synthesized by this mRNA? A. 4 B. 5 C. 6 D. 7 E. some other number 3. Imagine that you were examining the fatty acid composition of the phospholipids in the membranes of a cold blooded organism. You note that during the day, the fatty acid chains are longer and more unsaturated than during the night. What would be the best explanation for these observations? A. the organism is responding to changing temperature and trying to maintain membrane fluidity B. the organism is responding to the change in the light-dark cycle and trying to maintain membrane fluidity C. the organism eats during the day, so it has more cholesterol available with which to regulate phospholipid composition. D. the organism eats during the day, so there are better fatty acids available to incorporate into the membrane MCDB 1A Midterm 1 Pink (1) Version: 1 Page: 1 4. In the famous Hershey-Chase experiment that used radioactively labeled bacteriophage T2 and a blender, what is the most rigorous interpretation of the observation that S35 was found primarily in the supernatent rather than the pellet? A. Phage protein does enter the cells B. Phage protein does not enter the cells C. Phage DNA does enter the cells D. Phage DNA does not enter the cells 5. Is this the correct chemistry for peptide bond formation? A. Yes B. No 6. Which of the following is false regarding the stability of lipid bilayers? A. Lipid bilayers maximize hydrogen bonding between phospholipids and water B. Lipid bilayers maximize hydrophobic forces among the head groups of phospholipids C. Lipid bilayers maximize hydrophobic forces among the aliphatic chains of phospholipids D. None of the above three possibilities is a correct answer, because all of them are true. 7. How many ATP's does it take to synthesize a triglyceride as it was decribed in class?...
View Full Document

This note was uploaded on 09/28/2010 for the course SCI mcdb 1a & taught by Professor Bush during the Spring '10 term at UCSB.

Page1 / 8

MCDB_1A_Midterm_1_2009 - Name _________________________ TA

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online