Answers-BCHS-4306-Ex_37980

Answers-BCHS-4306-Ex_37980 - BCHS 4306 Exam#1 This exam...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BCHS 4306 Exam #1 September 30, 2008 This exam consists of 33 questions worth a total of 100 points and 2 bonus questions (34 and 35). All questions are multiple-choice. Each question has only ONE answer so choose the best answer. There are a total of 10 pages in this exam. The Genetic Code Table is on page 10. Make sure you bubble in your PEOPLESOFT ID number AND name on your scantron. Your exam score will be linked to the last 4-digits of the number you bubble in. Good luck! Name_________________________ Peoplesoft ID#_____________________ 1 1. Which of the following is NOT a difference between DNA and RNA? a. Thymine vs. Uracil b. Sugar is deoxyribose vs. ribose c. 2’-OH d. 3’-OH e. Double stranded vs. single stranded Answer: d 2. Which of the following is associated with DNA polymerase III? a. Used for synthesis of the leading strand b. Used for synthesis of the lagging strand c. Functions as a dimer d. Polymerizes dNTPs e. All of the above Answer: e 3. Which of the following is FALSE about the LEADING strand associated with DNA replication? a. Undergoes continuous synthesis b. Is associated with Okazaki fragments c. The sequence of the leading strand is identical to the template of the lagging strand d. Is synthesized in the 5’ to 3’ direction e. Starts off with an RNA primer Answer: b 4. Which of the following is FALSE about the LAGGING strand associated with DNA replication? a. Undergoes continuous synthesis b. Is associated with Okazaki fragments c. Needs DNA Ligase to connect the fragments d. Is synthesized in the 5’ to 3’ direction e. Starts off with an RNA primer Answer: a 5. Which is the following is NOT needed for telomere lengthening? a. Telomerase b. Telomerase-RNA 2 c. DNA polymerase d. dNTPs e. RNA polymerase Answer: e 6. Which of the following is NOT an error free repair system? a. Double stranded break followed by non-homologous end joining b. Double stranded break followed by homologous recombination c. Nucleotide excision repair d. Base excision repair e. Mismatch repair Answer: a 7. Shown below is a double stranded DNA region that needs to be repaired. CGATTGCC_ATTGGCACAGT | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | GCTAACGGGTAACCGTGTCA Which of the following is FALSE ? a. The mutation created an apurinic site b. The mutation created an apyrimidinic site c. The mutation will be repaired through base excision repair d. The repair needs AP endonuclease e. The repair needs DNA polymerase and ligase Answer: a 8. Which of the following is NOT a difference between replication and transcription?a difference between replication and transcription?...
View Full Document

This note was uploaded on 10/05/2010 for the course BCHS 3305 taught by Professor Briggs during the Spring '10 term at University of Houston-Victoria.

Page1 / 13

Answers-BCHS-4306-Ex_37980 - BCHS 4306 Exam#1 This exam...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online