study questions and answers 21

Study questions and - Study questions and answers 21 For the following three questions identify the reading frames translate the corresponding RNA

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Study questions and answers 21 For the following three questions identify the reading frames, translate the corresponding RNA, and determine the encoded polypeptide sequence. See the Codon table on p. 3. For all sequences, the promoter is located to the left of the shown sequence, pointing to the RNA pol enzyme to- ward the right. 1. 1 5 10 15 20 25 30 35 40 45 50 55 | | | | | | | | | | | | 5'-GGGTATGGATCCCTTATTATACTCTTCAAAAAAAGCTGTCTAATCTTGATTCATT-3' CCCAGACCTAGGGAATAATATGAGAAGTTTTTTTCGACAGATTAGAACTAAGTAA 2. 1 5 10 15 20 25 30 35 40 45 50 55 | | | | | | | | | | | | 5'-GATGGTGATCCCTTATTATACTCTTCACACATAGCTGTCTAATCTGAATTCATT-3' CTACCACTAGGGAATAATATGAGAAGTGTGTATCGACAGATTAGACTTAAGTAA 3. 1 5 10 15 20 25 30 35 40 45 50 55 | | | | | | | | | | | | 5'-GGTTGGTGATCCCTTATTATAATGTTCACACATAGCTGTCTAATCTGAATTCATT-3' CCAACCACTAGGGAATAATATTACAAGTGTGTATCGACAGATTAGACTTAAGTAA Using the sequence in question 3, change it demonstrate the following mutations: 4. Silent 5. Missense 6. Nonsense 7. Frameshift (insertion)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/06/2010 for the course BIO SCI 2A 54936 taught by Professor Comai during the Spring '10 term at UC Davis.

Page1 / 4

Study questions and - Study questions and answers 21 For the following three questions identify the reading frames translate the corresponding RNA

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online