answers study questions 16

answers study questions 16 - Answers to study questions 16...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Answers to study questions 16 1. Write the base-paired complementary strand underneath each of the following sequences, which are all listed 5' to 3': aaaaccctacgttc-3' ttttgggatgcaag-5' ttttgattacattt-3' aaaactaatgtaaa-5' cccctactctacat-3' ggggatgagatgta-5' ggggatcatcatgg -3'cccctagtagtacc-5' 2. Write the complementary strand, 5' to 3', for the following sequences, which are all listed 5' to 3': 5'-agctccctacgttc 5'-gaacgtagggagct 5'-tcgagattacattt 5'-aaatgtaatctcga 5'-cccgtactctacat 5'-atgtagagtacggg 5'-catcatcatcatgg 5'-ccatgatgatgatg 5'-gatgatgatgattt 5'-aaatcatcatcatc Consider the following sequence shown 5' to 3'. In a double stranded form this DNA undergoes replication. The origin of replication is centered at the boundary between aaaaa and ttttt. Illus- trate the following by drawing each structure with its sequence: ggggatgatgatgagctccctacgttcaaaaatttttgggggcgtcgtctctctcagattacta 3. The opening replication bubble 5'-ggggatgatgatgagctccctacgttcaaaaatttttgggggcgtcgtctctctcagattacta
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/06/2010 for the course BIO SCI 2A 54936 taught by Professor Comai during the Spring '10 term at UC Davis.

Page1 / 2

answers study questions 16 - Answers to study questions 16...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online