{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Exon 2 - Human Dysferlin cDNA blasted in Zebrafish genome...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Human Dysferlin cDNA blasted in Zebrafish genome Exon 1 – No significant similarity Exon 2 Query = human dysferlin cDNA seq. > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700) Length=6199740 Score = 42.8 bits (46), Expect = 0.005 Identities = 40/51 (78%), Gaps = 0/51 (0%) Strand=Plus/Minus Query 6 AAGAAGAGAACCAAAGTCATCAAGAACAGCGTGAACCCTGTATGGAATGAG 56 || |||| || ||||||||||| || | || || ||||| ||||||||| Sbjct 3621852 AAAAAGAAGACTAAAGTCATCAAAAATAATGTCAATCCTGTCTGGAATGAG 3621802 Exon 3 > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700) Length=6199740 Score = 68.0 bits (74), Expect = 3e-10 Identities = 70/92 (76%), Gaps = 0/92 (0%) Strand=Plus/Minus Query 1 GGATTTGAATGGGACCTCAAGGGCATCCCCCTGGACCAGGGCTCTGAGCTTCATGTGGTG || ||||| |||||||| ||||| | || | || ||| | ||||||||||| || Sbjct 3621673 GGCTTTGAGTGGGACCTGAAGGGTGTTCCTTTAGATTCGGGAGCAGAGCTTCATGTTGTC 3621614 Query 61 GTCAAAGACCATGAGACGATGGGGAGGAACAG 92 || ||||||||||||| ||||| ||||| || Sbjct 3621613 GTTAAAGACCATGAGAAAATGGGCAGGAATAG 3621582 Exon 4 – No significant similarity
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Exon 11 > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700)
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern