Exon 2 - Human Dysferlin cDNA blasted in Zebrafish genome...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Human Dysferlin cDNA blasted in Zebrafish genome Exon 1 – No significant similarity Exon 2 Query = human dysferlin cDNA seq. > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700) Length=6199740 Score = 42.8 bits (46), Expect = 0.005 Identities = 40/51 (78%), Gaps = 0/51 (0%) Strand=Plus/Minus Query 6 AAGAAGAGAACCAAAGTCATCAAGAACAGCGTGAACCCTGTATGGAATGAG 56 || |||| || ||||||||||| || | || || ||||| ||||||||| Sbjct 3621852 AAAAAGAAGACTAAAGTCATCAAAAATAATGTCAATCCTGTCTGGAATGAG 3621802 Exon 3 > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700) Length=6199740 Score = 68.0 bits (74), Expect = 3e-10 Identities = 70/92 (76%), Gaps = 0/92 (0%) Strand=Plus/Minus Query 1 GGATTTGAATGGGACCTCAAGGGCATCCCCCTGGACCAGGGCTCTGAGCTTCATGTGGTG || ||||| |||||||| ||||| | || | || ||| | ||||||||||| || Sbjct 3621673 GGCTTTGAGTGGGACCTGAAGGGTGTTCCTTTAGATTCGGGAGCAGAGCTTCATGTTGTC 3621614 Query 61 GTCAAAGACCATGAGACGATGGGGAGGAACAG 92 || ||||||||||||| ||||| ||||| || Sbjct 3621613 GTTAAAGACCATGAGAAAATGGGCAGGAATAG 3621582 Exon 4 – No significant similarity
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Exon 11 > ref|NW_001879254.1|Dr7_WGA700_3 Danio rerio chromosome 7 genomic contig, reference assembly (based on Zv7_scaffold700)
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/12/2010 for the course BC BC367 taught by Professor Millard during the Spring '10 term at Colby.

Page1 / 3

Exon 2 - Human Dysferlin cDNA blasted in Zebrafish genome...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online