2007 test - 1. Which of the following statements is...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1. Which of the following statements is correct? 1 0.004 a) a reaction is said to be spontaneous when it can proceed in either the forward or reverse direction. 0 0.000 b) a spontaneous process always happens very quickly. 243 0.957 c) a nonspontaneous reaction will proceed spontaneously in the reverse direction.## 3 0.012 d) a spontaneous process can occur only if there is a large decrease in entropy. 7 0.028 e) none of the rest. 2. Consider a reaction with delta H = 30 KJ and delta S = 100 J/K, the reaction is spontaneous at 0 0.000 a) 10 degree C 2 0.008 b) 15 degree C 0 0.000 c) 20 degree C 1 0.004 d) 25 degree C 251 0.988 e) 30 degree C## 3. The volume of a solution of 0.5 M HCl that must be added to adjust the pH from 9 to 4 in 20 mL of a 100 mM solution of phosphoric acid is: 2 0.008 a) 1 mL 27 0.106 b) 2 mL 4 0.016 c) 3 mL 219 0.862 d) 4 mL## 2 0.008 e) 5 mL 4. Indicate the ionic species that predominate at pH 3 I: Succinate(-2) II: Succinate(-1) III: Succinic acid IV: CO3(-2) V: HCO3(-) VI: H2CO3 2 0.008 a) I & IV 5 0.020 b) II & III 18 0.071 c) III & IV 3 0.012 d) II & V 226 0.890 e) III & VI## 5. Indicate the ionic species that predominate at pH 8 I: Succinate(-2) II: Succinate(-1) III: Succinic acid IV: H2CO3 V: HCO3(-) VI: CO3(-2) 16 0.063 a) I & IV 3 0.012 b) II & III 7 0.028 c) III & V 225 0.886 d) I & V## 3 0.012 e) III & VI 6. What is the effective buffering range of HEPES? 10 0.039 a) 6.2-8.2 238 0.937 b) 6.5-8.5## 1 0.004 c) 1.5-3.5 5 0.020 d) 7.1-9.1 0 0.000 e) 3.5-11.5 7. The pH of a 1L solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20ml of 5M HCL is (MOPS:pK=7.2; SHS:pK=5.5): 238 0.937 a) 1## 4 0.016 b) 1.5 3 0.012 c) 2.0 7 0.028 d) 2.5 2 0.008 e) 3.0 8. Which of the following statements is correct regarding buffer strength at pH = 6.4 (MOPS:pK=7.2; SHS:pK=5.5)? 9 0.035 a) MOPS is more effective against acid and SHS is more effective against base 238 0.937 b) MOPS is more effective against base and SHS is more effective against acid## 4 0.016 c) MOPS is more effective against both acid and base 2 0.008 d) SHS is more effective against both acid and base 0 0.000 e) None of the rest 9. Which of the following lists is the best choice of buffers for pH 3.8, 6.1 and 8.1 respectively 0 0.000 a) Tris, Succinic and Ammonia 249 0.980 b) Formic, MES, Tris## 0 0.000 c) Succinic, Tris and HEPES 4 0.016 d) Succinic, HEPES and Ammonia 1 0.004 e) HEPES, Phosphoric acid and Ammonia 10. Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 3.5). The fraction of aspirin available for absorption in the stomach (if pH=4.5) is 240 0.945 a) 1 /11## 4 0.016 b) 10/11 6 0.024 c) 1/101 1 0.004 d) 100/101 3 0.012 e) 1/1 11. Which of the following species is not Bronsted-Lowry acids? 0 0.000 a) HCOOH 4 0.016 b) NH4(+) 1 0.004 c) H2O 247 0.972 d) NH3## 2 0.008 e) H2PO4(-) 12. The pH of a 100 mL solution containing 50 mL of 1M acetic acid and 4.1g of sodium acetate (formula weight 82g/mol; pK=4.76) is 5 0.020 a) 2.76 18 0.071 b) 3.76 212 0.835 c) 4.76## 15 0.059 d) 5.76 4 0.016 e) 6.76 13. Which of the following restriction enzymes produce blunt ends (see Table 2)? 1 0.004 a) BamHI, HaeIII, PvuII, AluI 4 0.016 b) AluI, PvuII, BglI, EcoRV 0 0.000 c) EcoRV, EcoRI, HaeIII, PvuII 247 0.972 d) PvuII, EcoRV, HaeIII, AluI## 2 0.008 e) all of the rest 14. Which of the following restriction enzymes produce identical sticky ends (see Table 2)? 167 0.657 a) BamHI and BglII## 3 0.012 b) HpaII and XhoI 1 0.004 c) SalI and TaqI 50 0.197 d) All of the answer pairs 33 0.130 e) none of the rest 15. Which of the followings is true when a foreign DNA is being inserted into the PstI site of pBR322 (refer to Figure 1 for a map of pBR322) and introduced into E. coli cells? 13 0.051 a) Clones transformed with the recombinant plasmid are resistant to ampicillin 3 0.012 b) Clones transformed with the recombinant plasmid are sensitive to tetracycline 208 0.819 c) Clones transformed with pBR322 are resistant to both ampicillin and tetracycline## 7 0.028 d) Clones transformed with the recombinant plasmid are not sensitive to ampicillin 23 0.091 e) all of the rest 16. Which of the following primers can amplify the following DNA segment by PCR? GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGATA 8 0.031 a) 5'ATAGGCATAGGC and 5'TATCCGTATCCG 34 0.134 b) 5'ATAGGCATAGGC and 3'CTGACCAGCGCC 16 0.063 c) 5'CTGACCAGCGCC and 5'GACTGGTCGCGG 191 0.752 d) 5'TATCCGTATCCG and 3'GGCGCTGGTCAG## 5 0.020 e) 5'ATAGGCATAGGC and 5'CCGCGACCAGTC 17. Which of the following is always true concerning the base composition of DNA? 1 0.004 a) In each single strand, the number of A = T 0 0.000 b) In each single strand, the number of A = G 241 0.949 c) In a molecule of double stranded DNA, A + C = T + G## 7 0.028 d) In a molecule of double stranded DNA, the number of A + T = C + G 5 0.020 e) none of the rest 18. When compared to RNA, DNA lacks OH groups on the ______ of the pentoses: 1 0.004 a) 5' carbon 246 0.969 b) 2' carbon## 5 0.020 c) 3' carbon 0 0.000 d) 1' carbon 2 0.008 e) none of the rest 19. After a DNA molecule is cut into fragments by restriction endonucleases, these fragments are separated by Electrophoresis based on their: 249 0.980 a) size## 1 0.004 b) charge 1 0.004 c) shape 2 0.008 d) charge and shape 1 0.004 e) none of the rest 20. Which of the followings is not likely to cause problem in a PCR experiment? 2 0.008 a) both primers are inadvertently omitted from the reaction mixture 8 0.031 b) both primers are complementary to several sites in the starting DNA sample 223 0.878 c) there are two single-stranded breaks in one strand of the template DNA molecule## 14 0.055 d) there is a double-stranded break in the template DNA molecule 7 0.028 e) the temperature of the reaction mixture stayed constant all the time 21. Which one of the following processes do bacteria use to protect against restriction endonuclease activity? 1 0.004 a) Hydroxylation 2 0.008 b) Acetylation 251 0.988 c) Methylation## 0 0.000 d) Carboxylation 0 0.000 e) Amination 22. In gel electrophoresis of DNA, the fragment that travels the furthest is the ________. 0 0.000 a) least non-polar 1 0.004 b) most polar 2 0.008 c) medium size 1 0.004 d) largest 250 0.984 e) smallest## 23. DNA pol I can sequentially add deoxynucleotides to the ____ end of polynucleotides. 4 0.016 a) 5' 249 0.980 b) 3'## 0 0.000 c) 2' 1 0.004 d) 1' 0 0.000 e) None of the rest 24. Select the answer that arranges bond strength from weakest to strongest: 1 0.004 a) covalent, ionic, hydrogen bonds, van der Waals 2 0.008 b) van der Waals, ionic, hydrogen bonds, covalent 249 0.980 c) van der Waals, hydrogen bonds, ionic, covalent## 0 0.000 d) ionic, covalent, hydrogen, van der Waals 2 0.008 e) none of the rest 25. Which of the following DNA sequences is palindromic? 1 0.004 a) ACTAATGA 202 0.795 b) ACGATCGT## 1 0.004 c) CGATTTGC 0 0.000 d) AGATTACA 50 0.197 e) AGATTAGA ...
View Full Document

This note was uploaded on 10/11/2010 for the course ECONOMICS ECON 1B03 taught by Professor Holmes during the Fall '08 term at McMaster University.

Ask a homework question - tutors are online