H1N1 HA sequences USA student

H1N1 HA sequences USA student - Sequences are provided in...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Sequences are provided in this separate file because they are very lengthy. DO NOT Print. Use to copy and paste. • Each sequence is ~ 1700 nucleotides in length. There are 14 sequences given. Students can choose 5 or more. • It is recommended that you copy the 5 sequences that your group has chosen into your own MSWord file prior to using ClustalW. Name the MSWordfile per your Instructor’s directions. • Using ClustalW: Do not leave spaces between each sequence and include the headers at the beginning of each • These sequences are from USA and P uerto Rico >gi|77543297|gb|CY003296|/1-1727 /Human/4 (HA)/H1N1/USA/2003/01/14/ Influenza A virus (A/ New York/228/2003(H1N1)) segment 4, complete sequence AAAGTAAAACTACTGGTTCTGTTATGTACATTTACAGCTACATATGCAGACACAATATGTATAGGCTACCAT GCCAACAACTCAACCGACACTGTTGACACAGTACTTGAGAAGAATGTGACAGTGACACACTCTGTCAACCTA CTTGAGGACAGTCACAATGGAAAACTATGTCTACTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGC GTTGCCGGATGGATCTTAGGAAACCCAGAATGCGAATTACTGATTTCCAAGGAATCATGGTCCTACATTGTA GAAACACCAAATCCTGAGAATGGAACATGTTACCCAGGGTATTTCGCCGACTATGAGGAACTGAGGGAGCAA TTGAGTTCAGTATCTTCATTTGAGAGGTTCGAAATATTCCCCAAAGAGAGCTCATGGCCCAACCACACCGTA ACCGGAGTATCAGCATCATGCTCCCATAACGGGAAAAGCAGCTTTTACAGAAATTTGCTATGGCTGACGGGG AAGAATGGTTTGTACCCAAACCTGAGCAAGTCCTATGCAAACAACAAAGAGAAAGAAGTCCTTGTACTATGG GGTGTTCATCACCCGCCTAACATAGGGGACCAAAGGGCCCTCTATCATACAGAAAATGCTTATGTCTCTGTA GTGTCTTCACATTATAGCAGAAGATTCACCCCAGAAATAGCCAAAAGACCCAAGGTGAGAGATCAGGAAGGA AGAATCAACTACTACTGGACTCTGCTGGAACCCGGGGATACAATAATATTTGAGGCAAATGGAAATCTAATA GCGCCAAGGTATGCTTTCGCACTGAGTAGAGGCTTTGGATCAGGAATCATCACCTCAAATGCACCAATGGAT GAATGTGATGCGAAGTGTCAAACACCTCAGGGAGCTATAAACAGCAGTCTTCCTTTCCAGAATGTACACCCA GTCACAATAGGAGAGTGTCCAAAGTATGTCAGGAGTGCAAAATTAAGGATGGTTACAGGACTAAGGAACATC CCATCCATTCAATCCAGAGGTTTGTTTGGAGCCATTGCCGGTTTCATTGAAGGGGGGTGGACTGGAATGGTA GATGGTTGGTATGGTTATCATCATCAGAATGAGCAAGGATCTGGGTATGCTGCAGATCAAAAAAGCACACAA AATGCCATTAACGGGATTACAAACAAGGTGAATTCTGTAATTGAGAAAATGAACACTCAATTCACAGCTGTG GGCAAAGAATTCAACAAATTGGAAAGAAGGATGGAAAACTTAAATAAAAAAGTTGATGATGGGTTTCTAGAC ATTTGGACATATAATGCAGAATTGTTGGTTCTACTGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAAC GTGAAGAATCTGTATGAGAAAGTAAAAAGCCAATTAAAGAATAATGCCAAAGAAATAGGAAACGGGTGTTTT GAATTCTATCACAAGTGTAACGATGAATGCATGGAGAGTGTGAAAAATGGAACTTATGACTATCCAAAATAT TCCGAAGAATCAAAGTTAAACAGGGAGAAAATTGATGGAGTGAAATTGGAATCAATGGGAGTCTATCAGATC CTGGCGATCTACTCAACAGTCGCCAGTTCCCTGGTTCTTTTGGTCTCCCTGGGGGCAATCAGCTTCTGGATG TGTTCCAATGGGTCTTTGCAGTGTAGAATATGCATCTAAGACCAGAATTTCAGAAATATAAGAAAAACACC >gi|77747053|gb|CY003464|/1-1748 /Human/4 (HA)/H1N1/USA/2001/01/10/ Influenza A virus (A/ New York/442/2001(H1N1)) segment 4, complete sequence GGGAAAATAAAAACAACCAAAATGAAAGCAAAACTACTGGTCCTGTTATGTACATTTACAGCTACATACGCA GACACAATATGTATAGGCTACCATGCCAACAACTCAACCGACACTGTTGACACAGTACTTGAGAAGAATGTG ACAGTGACACACTCTGTCAACCTACTTGAGGACAGTCACAATGGAAAACTATGTCTACTAAAAGGAATAGCC CCACTACAATTGGGTAATTGCAGCGTTGCCGGATGGATCTTAGGAAACCCAGAATGCGAATTACTGATTTCC AAGGAATCATGGTCCTACATTGTAGAAACACCAAATCCTGAGAATGGAACATGTTACCCAGGGTATTTCGCC GACTATGAGGAACTGAGGGAGCAATTGAGTTCAGTATCTTCATTTGAGAGATTCGAAATATTCCCCAAAGGA...
View Full Document

This note was uploaded on 10/18/2010 for the course BIO 204 taught by Professor O'neal during the Fall '07 term at SUNY Stony Brook.

Page1 / 7

H1N1 HA sequences USA student - Sequences are provided in...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online