Lab7 A3PS2 DNA2 student f09

Lab7 A3PS2 DNA2 student f09 -...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
File of DNA sequences for Activity 3 Problem Set 2– Student Copy only DNA sequence 1 (Select any one of the three regions below for this sequence) Use the blastn algorithm for these sequences with the nonredundant (nr/nt) database >DNA sequence1 Region1 (1-180nt) tgtggggggtgtctttggggtttggttggttcggggtatggggttagcag cggtgtgtgtgtgctgggtaggatgggcgggggttgtattgatgagatta gtagtatgggagtgggaggggaaaataatgtgttagttggggggtgactg ttaaaagtgcataccgccaaaagataaaat >DNA sequence1 Region1 (301-540nt) tctgtgtggaaagtggctgtgcagacattcaattgttattattatgtcct acaagcattaattaattaacacactttagtaagtatgttcgcctgtaata ttgaacgtaggtgcgataaataataggatgaggcaggaatcaaagacaga tactgcgacatagggtgctccggctccagcgtctcgcaatgctatcgcgt gcataccccccagacgaaaataccaaatgcatggagagct >DNA sequence1 Region2 (961-1102nt) ggttttgatgtggattgggtttttatgtactacaggtggtcaagtattta tggtaccgtacaatattcatggtggctggcagtaatgtacgaaatacata gcggttgttgatgggtgagtcaatacttgggtggtacccaaatctgcttc cccatgaaagaa DNA sequence 2 >DNA sequence2 (153) tacacccggtaccagactctagagctagagaaggagtttcacttcaatcg
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ctacttgacccgtcggcgaaggatcgagatcgcccacgccctgtgcctca cggagcgccagataaagatttggttccagaatcggcgcatgaagtggaag aag DNA sequence 3 >DNA sequence3 (240nt) gttcctgtgtggagagatgcagataccaccctattttgtgcatcagatgc caaatcacatgtgacagaagcacacaatgtctgggccacacatgcctgtg tacccacagaccccaacccgcaagaaatacacctggaaaatgtaacagaa aattttaacatgtggaaaaataacatggtagagcagatgcaggaggatgt aatcagtttatgggagcaaagtctaaagccatgtgtaaag DNA sequence 4 >DNA sequence4 (480nt) cacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacg gcgggatataacacgagctgtcttcggtatcgtcgtatcccactaccgag atatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccct catttagcatttgcatggtttgttgaaaaccggacatggcactccagtcg ccttcccgttccgctatcggctgaatttgattgcgtgtgagatatttatg ccagcctgccagacgcagacgcgccgagacagaacttaatgggcctgcta acagcgcgatttgctggtgacccaatgcgaccaggtgctccacgcccagt cgcgtaccgtcttcatgggagaaaataatactgttgatgggagtctggtc agagacatcaagaaataacgccggaacatt...
View Full Document

This note was uploaded on 10/18/2010 for the course BIO 204 taught by Professor O'neal during the Fall '07 term at SUNY Stony Brook.

Page1 / 2

Lab7 A3PS2 DNA2 student f09 -...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online