Dr-1._Feinsteins_Exam-_Biochem_08

Dr-1._Feinsteins_Exam-_Biochem_08 - Name _ TA _ MCDB 1A...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Name _________________________ TA ________________________ MCDB 1A Midterm Examination 2 November 12, 2008 Scantron Instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles. 4. Write the color of your test in the space underneath the ID number box. 5. Fill in the entire rectangle of the answer you choose. If you erase, erase completely READ ALL QUESTIONS THOROUGHLY----IN ALL CASES, PICK THE BEST ANSWER 33 QUESTIONS - 3 POINTS EACH 1 POINT FOR WRITING THE COLOR OF YOUR TEST ON THE SCANTRON AND FILLING IN THE BUBBLES CORRECTLY (if you fail to do this correctly, you really will not earn that point!!!) STAY CALM, CONCENTRATE AND GOOD LUCK GENETIC CODE AT END OF TEST 1. If a particular DNA molecule has 29 % A's, what will be the percentage of G's? A. 19 % B. 21 % C. 25 % D. some other number E. there is no way to tell based on only the percentage of A's. 2. In macromolecular synthesis, which molecule serves to translate between the language of nucleic acids and the language of proteins? A. DNA B. tRNA C. mRNA D. more than one of the above can serve this function E. none of the above can serve this function Use the following mRNA to answer the next 2 questions 5' AUAUGCAUCCCAUGCAUAGCAGUUUUCAUUAUCAACCCUAACGCAUUCA 3' 3. How many amino acids will be in the protein synthesized from this mRNA? A. 4 B. 7 C. 9 D. 10 E. some other number corrected Midterm 2 Yellow (0) Version: 0 Page: 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4. What will be the third amino acid? A. serine B. arginine C. lysine D. cysteine E. some other amino acid 5. DNA ligase functions in the process of A. alternative RNA splicing B. transcription C. translation D. replication E. some other process in the cell 6. In the famous Hershey-Chase experiment, in which bacterial cells were infected with radioactively labeled viruses (also known as "phage"), the conclusion that DNA is genetic material and protein is not genetic material was warranted because: A. neither 32 P or 35 S entered the bacterial cells B. both 32 P and 35 S entered the bacterial cells C. 32 P, but not 35 S, entered the bacterial cells D. 35 S, but not 32 P, entered the bacterial cells 7. Consider the following reaction: amino acid 1 + amino acid 2 amino acid 1 -amino acid 2 . What can be said about the " ! G" for this reaction? A. It has a positive value. B. It has a negative value. C. It has a value close to 0 kcal/mol. 8. 70% of the cystic fibrosis cases in the US result from the deletion of one phenylalanine ("phe") in the middle of a chloride channel. Everything else in the primary structure of the protein is normal. At some point way back in history, there must have been an event that caused this mutation. The most likely molecular explanation for this causative event is: A. deletion of one nucleotide during transcription B. deletion of three nucleotides during transcription C. deletion of one nucleotide during replication
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/16/2010 for the course MCDB MCDB 1A taught by Professor Senghuilow during the Spring '09 term at UCSB.

Page1 / 8

Dr-1._Feinsteins_Exam-_Biochem_08 - Name _ TA _ MCDB 1A...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online