{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Dr-1._Feinsteins_Exam-_Biochem_08

Dr-1._Feinsteins_Exam-_Biochem_08 - Name TA MCDB 1A Midterm...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Name _________________________ TA ________________________ MCDB 1A Midterm Examination 2 November 12, 2008 Scantron Instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles. 4. Write the color of your test in the space underneath the ID number box. 5. Fill in the entire rectangle of the answer you choose. If you erase, erase completely READ ALL QUESTIONS THOROUGHLY----IN ALL CASES, PICK THE BEST ANSWER 33 QUESTIONS - 3 POINTS EACH 1 POINT FOR WRITING THE COLOR OF YOUR TEST ON THE SCANTRON AND FILLING IN THE BUBBLES CORRECTLY (if you fail to do this correctly, you really will not earn that point!!!) STAY CALM, CONCENTRATE AND GOOD LUCK GENETIC CODE AT END OF TEST 1. If a particular DNA molecule has 29 % A's, what will be the percentage of G's? A. 19 % B. 21 % C. 25 % D. some other number E. there is no way to tell based on only the percentage of A's. 2. In macromolecular synthesis, which molecule serves to translate between the language of nucleic acids and the language of proteins? Use the following mRNA to answer the next 2 questions 5' AUAUGCAUCCCAUGCAUAGCAGUUUUCAUUAUCAACCCUAACGCAUUCA 3 ' 3. How many amino acids will be in the protein synthesized from this mRNA? corrected Midterm 2 Yellow (0) Version: 0 Page: 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
4. What will be the third amino acid? 5. DNA ligase functions in the process of A. alternative RNA splicing B. transcription C. translation D. replication E. some other process in the cell 6. In the famous Hershey-Chase experiment, in which bacterial cells were infected with radioactively labeled viruses (also known as "phage"), the conclusion that DNA is genetic material and protein is not genetic material was warranted because: 7. Consider the following reaction: amino acid 1 + amino acid 2 amino acid 1 -amino acid 2 . What can be said about the " ! G" for this reaction?
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}