Lecture_13_2010

Lecture_13_2010 - Lecture 13 - 1 I. Multiple Alleles A....

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Lecture 13 - 1 I. Multiple Alleles A. Microsatellites B. Mating Patterns Problems: Chp. 21, 2-8, 18 Multiple alleles: 3 alleles at a single locus A, B, C If we have these alleles in the following frequencies: prob(A) = p = 0.5 With random mating: p .5 p 0.5 q 0.2 r 0.3 p2 = 0.25 pq = 0.1 pr = 0.15 q .2 pq = 0.1 q2 = 0.04 qr = 0.06 r .3 pr = 0.15 qr = 0.06 r2 = 0.09 prob(B) = q = 0.2 prob(C) = r = 0.3 AA AB AC BB BC CC Expected numbers 250 200 300 40 120 90 1000 Expected frequencies under HW p2 2pq 2pr q2 2qr r2 homozygotes (square of the allele frequency) heterozygotes (2 * product of the two allele frequencies) Lecture 13 - 2 PCR – see Figure 9.16 See Figure 11.12 in book (microsatellites) PCR: …5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’… …3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’… STEP 1: Denature (heat) 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ STEP 2: Anneal Primers (cool) 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3‘AGACTAGATTACGATGACAC5’ 5’GCTACATTCGCTAGCTAT- 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ STEP 3: Replicate 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ RESULT: 54 BASE PAIR PRODUCT IN LENGTH For another allele: 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ 5’GCTACATTCGCTAGCTATGAGAGAGAGAGAGAGAGAGAGATCTGATCTAATGCTACTGAG3’ 3‘AGACTAGATTACGATGACAC5’ 5’GCTACATTCGCTAGCTAT- 3’CGATGTAAGCGATCGATACTCTCTCTCTCTCTCTCTCTCTAGACTAGATTACGATGACAC5’ RESULT: 60 BASE PAIR PRODUCT IN LENGTH Lecture 13 - 3 On a gel we can separate pieces of DNA based on their length: __ __ __ __ Origin __ __ __ __ __ 60 bp 54 bp There can be many different alleles at microsatellite loci One type of mutation that microsatellites are especially prone to is by slippage of the DNA during replication, resulting in length mutations. There can be 40 or more alleles in a population. This is an image of a gel where 39 offspring of a single cross were genotyped at one microsatellite locus. Note that in each vertical lane there are always 2 (and only 2) band sizes. These are the two alleles for each offspring at the microsatellite locus. In each case, one of the alleles is from the egg and the other from the sperm. Can you determine the genotype of the mother & father? Lecture 13 - 4 How can we use microsatellites to answer questions in Ecology & Evolution? Mother M54M60 Offspring M54M56 (2) M54M48 (2,3) M60M56 (2) M48M60 (2,3) Potential Father1 M50M52 Father2 M48M56 Father3 M48M50 bold = maternal allele Mating in Emus Once thought to be monogamous Unusual because males provide parental care but field work revealed extra-pair copulations occur fairly frequently Problems in the field: Identifying all individuals Can’t make all observations extra-pair copulations may be more difficult to see copulation don’t = fertilization Emus: 18 nests, 106 chicks at 4 microsatellite loci: Genotyped the fathers rearing the chicks the chicks the females Determined: 54 (51%) chicks were not fathered by the nesting male 12 (11%) chicks were not mothered by the observed mate of the nesting male 9 (8%) chicks were not fathered by the nesting male or mothered by the observed mate of the nesting male (intra-specific brood parasitism) Only 11% of males fathered all of the chicks in their nest. Lecture 13 - 5 Example 2: Monogamy and size assortative mating in Seahorses Three microsattelite loci, 24-42 alleles per locus ...
View Full Document

This note was uploaded on 10/16/2010 for the course EEMB 129 taught by Professor Ajnarivera during the Spring '09 term at UCSB.

Ask a homework question - tutors are online