Lecture_14

Lecture_14 - This Week Transcrip.on and Transla.on M &...

Info iconThis preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This Week Transcrip.on and Transla.on M & W - Chapter 8 – Gene Expression Today – Transcrip.on W – Gene.c Code / Transla.on F – Chapter 9 – Tools in gene.cs
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Learning Goals Today Understand transcrip.on – frst step From genotype to phenotype Learn di±erences between prokaryote and eukaryote transcrip.on Understand 3 stages oF transcrip.on (see especially fgure 8²11) Understand how RNA is processed a³er transcrip.on (only in eukaryotes)
Background image of page 4
DNA IN NUCLEUS PROTEINS SYNTHESIZED IN CYTOPLASM (IN RIBOSOMES) How are proteins “made” from DNA?
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
DNA IN NUCLEUS PROTEINS SYNTHESIZED IN CYTOPLASM
Background image of page 6
Transcrip.on Ini.a.on Elonga.on Termina.on
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Transcrip.on - Facts RNA polymerase catalyzes transcrip.on Promoters signal RNA polymerase where to begin transcrip.on RNA polymerase adds nucleo.des in 5’ to 3’ direc.on Terminator sequences tell RNA when to stop transcrip.on
Background image of page 8
Promoters of 10 diFerent bacterial genes Fig. 8.12 “CAT Box” “TATA Box”
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
GenBank h‘p://www.ncbi.nih.gov/ GCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGATGCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAGAAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATGGACAGAACAACCTAATGAACACAGCA CCATGATGTGGTCTGTCCTTTTACAGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTATATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCACTTATCCACGGGGA TATTTTTATAATTATTTTTTTTATAGTTTTTAGATCTTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAAGGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATTACCCTCAAATGACAGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTG ACAGATTGCCCTCAGAAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTATTTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGGCGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATCGTCC AGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCAAAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCACCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCTGAAATATTCGGATTGACCTCTG CGGAAGCCAGTAAGGATATACGGCAGGCATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGGATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCCTGGTTTATCAAACGTGCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATAT CAACCCATATCTCATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTAGTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCCCTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAATCGACTGG ATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGCCTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGCAGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGACGACTCATATCGTATTTTCCTTCCGC GATATCACTTCCATGACGACAGGATAGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTTCTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTGCATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGC CAAATTTGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTGACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCACAGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTTTTTCCCACGGTGG ATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGACAGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTACACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCTTCTTATCTCCTTTTGTAGTGTTGCTCTTATTT
Background image of page 10
Image of page 11
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 29

Lecture_14 - This Week Transcrip.on and Transla.on M &...

This preview shows document pages 1 - 11. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online