BIS002A MT3 Practice S10 Comai

BIS002A MT3 Practice S10 Comai - BIS2A Midterm 3, Comai,...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
BIS2A Midterm 3, Comai, Spring xxxx Note : some of the genetics problems here may or may not be be covered in the current exam 3 depending on lecture coverage in 2010. All are good practice though and will help you learn and feel conFdent about your skills. 1 You discover a new yeast that expresses only a single type of RNA polymerase. In this organism you find that all RNA polymers are synthesized by this single RNA polymerase, which you call " RNA Pol Total ". In an individual of this species, a mutation causes RNA Pol Total to fail. Indicate which of the following processes is not expected to be affected by this failure. a Initiation of leading strands at replication forks b Initiation of lagging strands at replication forks c Transcription d Unwinding of DNA by DNA helicase e Synthesis of ribosomal components Transcription of the double stranded molecule shown below results in molecule G10: 1 5 10 15 20 25 30 35 40 45 50 55 | | | | | | | | | | | | 5'-AGCTATACTCCCTATAAGTAGATCTAAATTTTCTACCGTATACTAGATCTACTTTT-3' TCGATATGAGGGATATTCATCTAGATTTAAAAGATGGCATATGATCTAGATGAAAA G10 5'-AAAUUUUCUACCGUAUACUAGAUCUACUUUU-3 ' 2. The synthesis of G10 initiated at position _______ and used as a template the ________ strand (3pt) a 56, top d 1, bottom b 26, bottom e 56, bottom c 26, top 3. The process leading to the synthesis of G10 was initiated by an element called the ___________ and positioned approximately _______________ a origin, left of 35 d promoter, left of 15 b promoter, right of 40 e origin, between 5 and 25 c terminator, between 10 and 204 The molecule 5'-CTGATAGAC-3 ' is the product of DNA polymerase using the following template strand - 1 -
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
a GTCTATCAG-3' d TTGTTAGTC-3' b GACTATCGT-3' e GGTCCTGAT-3' c TAGTCTTGT-3' 5 The molecule 5'AUCAG 3' , could serve as a primer on the following template strand:5' to 3' a GTCTATCAG-3' d TTGTTAGTC-3' b GACTATCGT-3' e GGTCCTGAT-3' c TAGTCTTGT-3' 6 A plausible reason for the widespread occurrence of sexual reproduction is to (3pt): a produce favorable combination of alleles b increase the frequency of mutations
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 8

BIS002A MT3 Practice S10 Comai - BIS2A Midterm 3, Comai,...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online