Cavaillon1

Cavaillon1 - Related Commentary, page 3166 Research article...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Related Commentary, page 3166 Research article Psychological stress downregulates epidermal antimicrobial peptide expression and increases severity of cutaneous infections in mice Karin M. Aberg,1 Katherine A. Radek,2 Eung-Ho Choi,3 Dong-Kun Kim,3 Marianne Demerjian,1 Melanie Hupe,1 Joseph Kerbleski,1 Richard L. Gallo,2 Tomas Ganz,4 Theodora Mauro,1 Kenneth R. Feingold,1 and Peter M. Elias1 1Dermatology and Medical (Metabolism) Services, Veterans Affairs Medical Center, Department of Dermatology, and Department of Medicine, UCSF, San Francisco, California, USA. 2Dermatology Service, Veterans Affairs Medical Center, and Department of Dermatology, UCSD, La Jolla, California, USA. 3Department of Dermatology, Yonsei University, Wonju, Republic of Korea. 4Division of Pulmonary, Critical Care Medicine, and Hospitalists, UCLA David Geffen School of Medicine, Los Angeles, California, USA. The skin is the first line of defense against microbial infection, and psychological stress (PS) has been shown to have adverse effects on cutaneous barrier function. Here we show that PS increased the severity of group A Streptococcus pyogenes (GAS) cutaneous skin infection in mice; this was accompanied by increased production of endogenous glucocorticoids (GCs), which inhibited epidermal lipid synthesis and decreased lamellar body (LB) secretion. LBs encapsulate antimicrobial peptides (AMPs), and PS or systemic or topical GC administration downregulated epidermal expression of murine AMPs cathelin-related AMP and β-defensin 3. Pharmacological blockade of the stress hormone corticotrophin-releasing factor or of peripheral GC action, as well as topical administration of physiologic lipids, normalized epidermal AMP levels and delivery to LBs and decreased the severity of GAS infection during PS. Our results show that PS decreases the levels of 2 key AMPs in the epidermis and their delivery into LBs and that this is attributable to increased endogenous GC production. These data suggest that GC blockade and/or topical lipid administration could normalize cutaneous antimicrobial defense during PS or GC increase. We believe this to be the first mechanistic link between PS and increased susceptibility to infection by microbial pathogens. Introduction Multiple converging lines of evidence suggest that psychological  stress (PS), if sustained, can adversely impact critical functions  such as immune surveillance (1), gastrointestinal integrity (2–4),  coronary artery disease (5, 6), and wound healing (7–12). Although  recent studies in both humans and experimental animals suggest  that PS compromises host defenses against bacterial and viral  infections (13–21), the pathogenic mechanisms remain unknown.  Three potentially interconnected mechanisms have been proposed  to explain the negative impact of PS on host defenses against  infection and neoplasia: (a) psychoneuroimmunoendocrine dysfunction, which leads to increased proinflammatory neuropeptide and cytokine production in a manner either dependent or  independent of the hypothalamic-pituitary-adrenal (HPA) axis  (18–24); (b) increased plasma levels of endogenous glucocorticoid  (GC) caused by activation of the HPA axis (16, 18–21, 24, 25); and  (c) a cutaneous steroidogenic system, with localized production of  corticotropin-releasing factor (CRF) (26, 27), which could mediate  the adverse effects of PS on skin. Nonstandard abbreviations used: AMP, antimicrobial peptide; CRAMP, cathelinrelated AMP; CRF, corticotropin-releasing factor; GAS, group A Streptococcus pyogenes;  GC, glucocorticoid; GCr, GC receptor; HPA, hypothalamic-pituitary-adrenal;   LB, lamellar body; mBD, mouse β-defensin; PS, psychological stress; SC, stratum  corneum. Conflict of interest: The authors have declared that no conflict of interest exists. Citation for this article: J. Clin. Invest. 117:3339–3349 (2007). doi:10.1172/JCI31726. The negative consequences of PS on critical epithelial functions  (in contrast to those of other tissues) such as epidermal permeability  barrier  homeostasis  (28–30)  could  be  ascribed  largely  — if not entirely — to a PS-induced increase in circulating levels  of GCs, because blockade of either GC production by systemic  administration of a CRF inhibitor or GC peripheral action with  a GC receptor (GCr) antagonist normalizes permeability barrier  function in mice subjected to multiple forms of PS (31, 32). The  central role of a PS-induced increase in endogenous GCs is further supported by the observation that short-term administration  of either systemic or topical GCs produces an almost-identical  spectrum of epidermal abnormalities (33). The adverse effects of PS or GC increase on cutaneous permeability barrier function can be further ascribed to an inhibition  of epidermal lipid synthesis, leading to decreased production of  epidermal lamellar bodies (LBs) (33, 34), multifunctional organelles that deliver endogenous lipids, desquamatory enzymes, and  antimicrobial  peptides  (AMPs)  to  the  stratum  corneum  (SC)  interstices, thereby providing for the permeability and antimicrobial barriers (35, 36). As noted above, LBs in human epidermis  encapsulate and secrete not only lipids, but also at least 2 AMPs,  β-defensin (hBD2) and the cathelicidin hCap18 carboxyterminal  fragment LL-37 (37, 38). Because our prior studies showed that  protein delivery to nascent epidermal LBs is dependent upon prior  or concurrent deposition of lipids within this organelle (39), we  hypothesized that PS, by inhibiting epidermal lipid synthesis and  3339 The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  research article related  AMP  (CRAMP)  and  mouse  β -defensin  3  (mBD3;  the  closest  murine homolog of hBD2) protein  levels in mice subjected to a global  form of PS (i.e., combined insomnia-,    noise-,  and  crowding-induced  PS  sustained for up to 72 h; refs. 32, 34).  Both immunostainable CRAMP and  mBD3 protein were readily detected  by immunofluorescence throughout  the  epidermis  of  nonstressed  control mice (Figure 1, A and D). Western  immunoblotting  also  showed  a 3- to 4-kDa band in epidermis of  nonstressed normal mice under basal  conditions  (Supplemental  Figure  1G; supplemental material available  online with this article; doi:10.1172/ JCI31726DS1),  further  confirming  the specificity of the mBD3 antibody.  Figure 1 In contrast, PS provoked a decline in  PS downregulates epidermal AMP expression . Normal hairless mice (n = 3 each for immuno­ histochemistry and RT­PCR studies; 3–4 replications for each experiment in these and subsequent both epidermal CRAMP and mBD3  experiments) were exposed to insomnia­ and crowding­induced PS (B and E) for 72 h, while littermate immunostainable protein (Figure 1, B  controls (A and D) were not stressed. Frozen sections (8 μm) were stained with primary antibodies to and E; see Supplemental Figure 1 for  CRAMP and mBD3 and processed as described in Methods (for controls, see Supplemental Figure 1). controls, including immunostaining  Throughout the figures, white arrows indicate normal levels of positive immunostaining (green); white for mBD3 in CRAMP knockout epiarrowheads indicate reduced staining; asterisks indicate positive immunostaining of pilosebaceous dermis).  Moreover,  AMP  immunofollicles; and “d” and “e” indicate dermis and epidermis, respectively. (C and F) mRNA was extracted staining declined not only in epiderfrom PS and control mouse epidermis, followed by quantitative RT­PCR (see Methods). Normaliza­ mis, but also to an equivalent extent  tion in this and all subsequent studies was to 18S mRNA, with 2–3 replicates per sample (n = 3 per in  cutaneous  pilosebaceous  struc cohort). Scale bars: 50 μm. *P = 0.007. tures in PS-exposed mice (Figure 1, B  and E, asterisks). PS did not significantly alter epidermal mRNA levels  LB production in a GC-dependent manner, could prevent deliv- for mBD3 (Figure 1F), although the decline in CRAMP protein  ery of both these AMPs to these organelles. If PS decreases AMP  correlated with decreased epidermal cathelicidin mRNA levels  bioavailability in epidermis, the link between PS/epidermal lipids  (Figure 1C). These results show that PS downregulated CRAMP  and LB/AMP could then explain the apparent increased occur- at the mRNA and protein levels, while PS decreased mBD3 at the  rence of cutaneous infections in association with PS (14, 16, 17).  protein level only; the decline in both AMP proteins in pilosebaWe hypothesized further that if the putative link between PS and  ceous epithelia suggests that PS could also downregulate AMPs in  decreased AMP production is mediated by increased production  extraepidermal epithelia. of endogenous GCs and/or peripheral action of GCs, then AMP  As with PS, exogenous GCs downregulate epidermal AMP expression. To  expression could be normalized by blockade of endogenous GC  test whether the negative effects of PS can be attributed to increased  production or peripheral action. Finally, because the negative  endogenous GCs, we initially ascertained whether supraphysiologic  effects of PS or GC increase on epidermal lipid synthesis and LB  doses of systemic or topical GCs downregulate epidermal AMP proproduction can be overcome by topical physiologic lipid replace- duction. For the studies with systemic GCs, we administered 450  ment (33, 34), we hypothesized that comparable lipid replenish- μg/kg dexamethasone intraperitoneally to hairless mice 3 times  ment could also restore production/bioavailability of one or both  over 72 h, a dose previously shown to compromise epidermal difAMPs. Our studies determined that PS decreases levels of 2 key  ferentiation, proliferation, lipid synthesis, and permeability barrier  AMPs in the epidermis by divergent mechanisms, both ultimately  function (32–34). Whereas intraperitoneal administration of vehicle    mediated by an increase in endogenous GC. This decrease in AMP  alone to normal mice (Figure 2, B and E) did not alter either CRAMP  increased the severity of cutaneous GAS infections, and GC block- or mBD3 levels compared with untreated controls (Figure 2, A and  ade and/or topical physiologic lipids could normalize epidermal  D), systemic GCs markedly downregulated immunostaining for  antimicrobial defense in the face of PS/GC. Finally, we demon- CRAMP and mBD3 protein levels both in epidermis and in pilosestrated that physiologic GC account for the low, constitutive  baceous structures (Figure 2, C and F, asterisks). expression of these AMP under nonstressed conditions. Topical administration of the “superpotent” class I topical GC  clobetasol,  like  systemic  GCs,  also  alters  permeability  barrier  homeostasis by inhibiting epidermal lipid synthesis, which leads to  Results PS downregulates murine epidermal cathelicidin and mouse β-defen- decreased epidermal LB production (33). Hence, we next assessed  sin 3 protein levels by divergent mechanisms. To ascertain whether  whether topical clobetasol, like systemic GCs, also alters epidermal  PS modulates epidermal AMP levels, we first assessed cathelin- AMP expression. Protein levels for both CRAMP and mBD3 mark3340 The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007 research article Figure 2 Systemic steroid­induced downregulation of epi ­ dermal AMPs mimics effects of PS. Cohorts of normal hairless mice (n = 3 per cohort) received intraperitoneal dexamethasone (dex; 450 μg/cell/kg daily for 3 d, C and F) or vehicle alone (daily for 3 d, B and E) or were left untreated (A and D). Biopsies were obtained for immunostaining for CRAMP and mBD3 (see Methods). Scale bar: 50 μm. edly declined after 3 applications of topical clobetasol over a 72-h  time period (Figure 3). Finally, in contrast to both PS and systemic  GCs, topical GCs did not appear to reduce immunostaining for  AMPs in pilosebaceous structures (Figure 3, B and D, asterisks).  However, because these hairless mice have less prominent pilosebaceous ducts, it is possible that clobetasol would suppress AMP  production within follicles of hairy mice. Finally, to clarify further whether the PS-induced increase in  endogenous GCs inhibits AMP expression at the mRNA or protein level, we next added dexamethasone (10 nM) to second-passage cultured human keratinocytes. Whereas keratinocyte mRNA  levels for LL-37 (the cathelicidin human homolog) declined in  response to dexamethasone treatment, mRNA levels for hBD2  (the human homolog of mBD3) did not change (Supplemental  Figure 2). Together, these results further suggest that GCs regulate  CRAMP/LL-37 mRNA and protein expression, while hBD2/mBD3  is regulated at the protein level alone. PS-induced AMP downregulation is mediated by increased endogenous GCs. Prior studies have demonstrated that a PS-induced increase  in endogenous GCs largely accounts for the negative effects of PS  on epidermal structure and function (31, 32, 34). To assess whether a PS-induced increase in endogenous GCs also accounts for  the PS-induced decline in AMP levels, we first assessed whether  blockade of GC peripheral action by systemic administration of  the GCr inhibitor mifeprostone (RU-486) would restore epidermal AMP levels in the face of ongoing PS. PS again suppressed  immunostaining for both CRAMP and mBD3 in epidermis (Figure 4, compare B and F with A and E). Yet when PS mice were  cotreated with RU-486, epidermal protein levels for both CRAMP  and mBD3 normalized, or even appeared to increase to supernormal levels (Figure 4, C and G). Moreover, RU-486 cotreatment also  normalized AMP immunostaining in pilosebaceous structures  (Figure 4, C and G, asterisks). Whereas the results of the experiment with RU-486 suggest that  the PS-induced downregulation of AMP expression results from  peripheral action of GCs, RU-486 exhibits broad, and sometimes  unrelated, pharmacologic activities. Hence, we next employed an  alternate approach to assess the role of increased GCs by determining whether increased endogenous GC production also downregulates AMP expression during PS. For these studies, during ongoing  PS we coadministered antalarmin (a pharmacologic inhibitor of  CRF) intraperitoneally to block GC production.  Like  RU-486,  antalarmin  cotreatment  again  appeared to normalize or supernormalize both  mBD3 and CRAMP immunostaining in the face  of ongoing PS (Figure 4, compare D and H with  A and E). Finally, antalarmin also increased AMP  immunostaining  in  pilosebaceous  structures  (Figure 4, D and H, asterisks). Together, these  results strongly suggest that the adverse effects  of PS on epidermal and pilosebaceous AMP production can be  attributed to an increase in endogenous GC production and/or  peripheral action. PS-induced downregulation of AMP delivery to epidermal LBs is reversed by GC blockade. As described above, the human homologs of CRAMP  and mBD3 (LL-37 and hBD2, respectively) are sequestered within  epidermal LBs in preparation for their putative secretion into the  SC interstices. We next used immunoelectron microscopy to ask  whether PS alters the loading of mouse AMPs into nascent LBs.  In mice subjected to mice, LBs not only were reduced in number  (see below), but also demonstrated little or no immunolabeling for  either CRAMP or mBD3 (Figure 5, A and B). Where labeling was  present in PS mice, it was scattered instead at low levels throughout the cytosol of stratum granulosum cells (Figure 5, A and B,  circles). In contrast, when PS mice were cotreated with RU-486,  many LBs again demonstrated immunolabeling of both AMPs  within their internal contents. Finally, we quantified the extent of  LB immunolabeling for CRAMP and mBD3 in randomized, coded  Figure 3 Superpotent topical steroid also downregulates epidermal AMPs . Normal hairless mice (n = 3 per group) were treated topically with e ither clobetasol (0.05%, B a nd D ) or vehicle (60 μ l to a 3­cm 2 a rea, A a nd C ) once daily for 3 d. Frozen sections (8 μ m) were immunostained for either CRAMP (A and B) or mBD3 (C and D) (see Methods). Scale bar: 50 μm. 3341 The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  research article Figure 4 PS­induced downregulation of epidermal AMPs is reversed by blockade of endogenous GC production and/or action. Hairless mice (n = 3 per group) were exposed to PS with concurrent intraperitoneal administration of either RU­486 (C and G), antalarmin (ant; D and H), or vehicle (B and F). For dosage, timing, and drug concentrations, see Methods. Frozen sections (8 μm) were immunostained with CRAMP (A–D) or mBD3 (E–H) primary antibodies (see Methods). Samples A and E were from untreated control littermates. Scale bar: 50 μm. micrographs from PS mice with or without RU-486 treatment as  well as nonstressed mice. Labeling for both AMPs declined by over  80% in LBs of PS versus nonstressed mice, but it either normalized  or became supernormal in PS mice cotreated with RU-486 (Figure  5, C and D). Together, these results demonstrate first, by an alternate method, that PS reduces production and/or delivery of AMPs,  and second, that such reduced delivery to LB reflects a PS-induced  increase in endogenous GCs. Endogenous GCs account for low constitutive levels of AMP production in normal epidermis. Because both hBD2 and cathelicidin demonstrate  low, constitutive expression in normal human epidermis (40, 41),  and because blockade of endogenous GCs in PS mice resulted in  supernormal AMP immunostaining, we next asked whether the low  expression of these AMPs can be attributed to physiologic levels  of endogenous GCs. Indeed, both RU-486 and antalarmin treatment increased immunostaining for mBD3 and CRAMP in normal  murine epidermis (Figure 6, A–C and E–G). Moreover, blockade in  the production and/or action of endogenous GCs also increased  immunostaining for both AMPs in pilosebaceous structures (Figure  6, B, C, F, and G, arrows). Furthermore, epidermal immunostaining  for CRAMP and mBD3 increased markedly in adrenalectomized  mice (differences for CRAMP were more striking than for mBD3;  Figure 6, D, H, I, and J), as did immunolabeling of both AMPs in  pilosebaceous follicles (Figure 6, D and H, arrows). Yet, despite the  adverse effects of excess GCs on epidermal structure and function  (see above), adrenalectomy did not improve epidermal permeability  barrier homeostasis (Supplemental Figure 3). These results strongly  suggest that the low constitutive expression of mBD3 and CRAMP  in epidermis and appendages can be attributed to physiologic levels  of endogenous GCs, but such physiologic levels of GCs do not alter  cutaneous permeability homeostasis. Exogenous lipids override the negative effects of PS and GCs on mBD3, but not CRAMP, expression and delivery to LB. Topical replacement of  the 3 inhibited lipids (cholesterol, ceramides, and free fatty acids)  3342 reverses PS- or GC-induced abnormalities in epidermal LB production (33, 34) (Supplemental Figure 4), and protein delivery to LB is  dependent upon prior and/or concurrent lipid deposition within  these organelles (39). Hence, we next asked whether coadministration of a mixture of ceramides, cholesterol, and free fatty acids  at a 1:1:1 molar ratio, designed to correct the PS- or GC-induced  inhibition of epidermal lipid synthesis (33, 34), normalizes AMP  production in the face of PS. Both PS and GCs again downregulated mBD3 and CRAMP protein levels (Figure 7, A, B, D, and E,  and Supplemental Figure 5). As previously described (33, 34), the  topical lipid mixture normalized both the density (i.e., production)  of LB and the LB content in the face of PS or topical GC therapy  (Supplemental Figure 4). Yet, while the coapplied lipid mixture  partially normalized mBD3 immunolabeling in the face of both PS  and topical GCs (Figure 7, C and F), it failed to increase CRAMP  immunolabeling under the same conditions (Supplemental Figure 5), effectively ruling out the possibility that the lipids could be  interfering with GC uptake. Furthermore, as noted above, topical  lipid treatment of PS animals increased mBD3, but not CRAMP,  uptake into epidermal LBs (Figure 5, A, B, E, and F). Finally, the  topical lipids did not reverse the PS-induced decline in either  CRAMP or mBD3 immunostaining of pilosebaceous structures  (Figure 7, C and F, arrows, and Supplemental Figure 5). These  results show that topical lipid replacement partially normalized  the epidermal protein levels of mBD3 as well as the deposition of  this AMP within epidermal LBs, consistent with posttranscriptional regulation of expression of this AMP by PS or GCs. Conversely, lipid replacement increased neither CRAMP protein levels  nor deposition in LB, consistent with regulation of this AMP by PS  or GCs instead at a transcriptional level. PS-induced decline in epidermal AMPs correlates with increased susceptibility to cutaneous infections and is mediated by GCs . Prior studies  have shown that CRAMP knockout mice exhibit increased susceptibility to group A Streptococcus pyogenes (GAS) skin infections (42).  The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007 research article Figure 5 PS­induced decrease in AMP delivery to epidermal LBs is reversed by RU­486. (A and B) Ultrathin sections labeled with CRAMP (A) and mBD3 (B) primary antibodies followed by a 10­nm colloidal gold–tagged secondary antibody after embedding for electron microscopy. Sections were postfixed in osmium tetroxide and embedded in LR White medium. Black arrows denote unlabeled LBs; circles indicate label in cytosol. (A) CRAMP was labeled (black arrowheads) in nonstressed normal controls (Co), and CRAMP labeling reappeared in PS mice treated with RU­486 (PS+Ru), but not with exogenous lipids (PS+L). (B) Exogenous lipids restored labeling of mBD3 in LB in PS mice (black arrowheads). Scale bars: 100 nm. (C–F) Quantitative data for immunolabeling of CRAMP and mBD3 in LB in nonstressed control or PS mice plus either RU­486 (C and D) or lipid (E and F) cotreatment. *P < 0.05; **P < 0.001. Because PS substantially reduced CRAMP levels in both epidermis  and skin appendages, we next assessed directly whether PS increases the severity of cutaneous GAS infections. In nonstressed mice,  skin abscesses peaked in size at 20 ± 10 mm 4 d after intracutaneous inoculation of GAS, receding to 10 ± 3 mm by 5 d (Figure 8).  In PS mice, mean lesion size was almost twice that of nonstressed  mice, and abscesses persisted longer. In contrast, when PS mice  were cotreated with RU-486, skin abscesses were comparable in size  to those of nonstressed mice (Figure 8, C and D). However, RU486 did not decrease the severity of GAS infections in nonstressed  mice. Together, these results demonstrate that the PS-induced,  GC-mediated reduction in AMPs has negative consequences for  resistance to cutaneous GAS infection. Discussion PS adversely effects the function of epithelial tissues, including  the epidermis, where it perturbs both epidermal permeability  barrier homeostasis (28–31) and cutaneous wound healing (1,  3, 7–12). Although PS-induced functional abnormalities (23, 43,  44) are often attributed to psychoneuroimmune abnormalities,  PS-induced stimulation of endogenous GC production, which  compromises both epidermal lipid synthesis and LB production, accounts for epidermal dysfunction (32–34). Because PS increases  systemic GC levels and systemic administration of both the CRF  inhibitor antalarmin and the GCr antagonist RU-486 completely  normalize function, HPA-derived GCs are likely important mediators of the effects of PS on epidermal function. Yet the recently  described cutaneous steroidogenic system (26, 27, 45, 46) could  also be a participant, because the skin elaborates not only CRF (47,  48), but also corticosteroids, which are generated by different types  of cells within the skin (49, 50). We show here that PS also inhibited another key function: antimicrobial defense. Moreover, the decrease in epidermal AMP production was sufficient to increase the severity of infections from at  least one important bacterial pathogen, GAS. Thus, the PS-induced  decline in AMPs could account for the association between PS and  3343 The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  research article Figure 6 Endogenous GCs downregulate AMP expression in normal mouse epidermis . Immunostaining for CRAMP (A–D) and mBD3 (E–H) mRNA expression was assessed in biopsies from normal hairless mice (n = 3 per group) treated with RU­486 (B and F), antalarmin (C and G), or vehicle (A and E) and from cohorts of adrenalectomized (adrex; D, H, I, and J) and sham­operated (I and J) hairless Skh1 mice (n = 3 per group). Scale bar: 50 μm. *P = 0.04; **P = 0.006. the reported increased risk of cutaneous infections in the face  of PS. Accordingly, abundant anecdotal evidence connects PS to  outbreaks or progression of viral skin infections including herpes  simplex, Epstein-Barr virus, HIV, influenza, and varicella/zoster  virus infections (14, 16–19, 21, 25); mucosal bacterial infections  such as bacterial vaginitis (51); and inflammatory dermatoses such  as acne, in which microbial colonization indisputably aggravates  disease expression (52). Finally, because PS exerts potent systemic  effects via an increase in endogenous GCs (see below), it is highly    likely that these results have  implications for extracutaneous  infections that occur in the face of either increased PS or systemic  or topical GC therapy. Indeed, while it is generally accepted that  increased endogenous GCs increase susceptibility to infection, the  link to PS is more tenuous (53). First we explored whether PS — which has well-known, adverse  effects on permeability barrier homeostasis in humans and hairless  mice (29, 30) — also adversely affects cutaneous AMP expression.  In a well-characterized model of sustained PS (insomnia, crowding, and auditory stimulation in hairless mice; refs. 32, 34), we  showed that PS downregulated the expression of both the murine  cathelicidin CRAMP and the murine β-defensin mBD3. The fact  that PS and GCs produce negative effects in human epidermis (29,  30, 33) comparable to those in hairless mice (32–34) validates the  further use of hairless mice as a model for these studies. Nevertheless, it remains possible that some of the PS-induced effects  observed here could be influenced by the absence-of-function hr  3344 gene product(s), because comparable studies were not performed  in normal mouse skin. We focused here on CRAMP and mBD3 because the human  homologs of these 2 AMPs are known products of the epidermal LB secretory system (37, 38), and therefore, their expression  could be influenced by PS or GCs, both of which reduce LB production (33, 34). Although the constitutive expression of these  peptides is reportedly low in normal epidermis (41, 54), these  peptides are readily detectable in normal murine epidermis by  immunofluorescence, even under basal conditions, allowing us to  readily discriminate further PS-induced declines in AMP protein.  While PS reduced protein levels for both CRAMP and mBD3, only  CRAMP declined at the mRNA level, suggesting different levels of  regulation by PS for CRAMP and mBD3 (Figure 9 and see below). We next addressed the mechanisms whereby PS adversely alters  AMP expression. Because the adverse effects of PS on epidermal  permeability barrier function are mediated by increased endogenous GCs (31, 32), we hypothesized that the effects of PS on AMP  production (and on increased susceptibility to skin infections)  could be attributable to increased endogenous GCs. Accordingly,  both systemic and topical GCs downregulated protein levels for  both CRAMP and mBD3. But systemic GCs, like PS, did not reduce  mRNA levels for mBD3. Pertinently, systemic GCs also downregulate NFκB-dependent expression of at least one AMP in amphibian  skin  (51).  The  PS-endogenous  GC  mechanism  is  strongly  supported by the dual observations that blockade of GC increase  The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007 research article Figure 7 Coapplication of topical physiologic lipids par­ tially normalizes mBD3 expression in the face of PS or increased GCs. Hairless mice (n = 4 or 5 per cohort) received either an equimolar mixture of ceramides, cholesterol, and free fatty acids (1:1:1 molar ratio; 2% final con­ centration) in propylene glycol/ethanol (7:3 v/v) vehicle (60 μl to a 3­cm2 area) or vehicle alone, while being cotreated with either PS (E and F) or topical clobetasol (GC, B and C). Frozen sections were immunostained for mBD3 (see Methods). Controls treated only with vehicle are shown in A and D. Scale bars: 50 μm. with systemic administration of the CRF inhibitor antalarmin and  blockade of GC peripheral action with systemic administration  of the GC inhibitor RU-486 both normalized AMP expression in  the face of ongoing PS. The final proof of a PS-GC connection is  shown by the observation that PS amplified the severity of cutaneous GAS infections, while conversely, systemic administration  of RU-486 normalized resistance to this bacterial pathogen in the  face of ongoing PS. Together, these studies show the important  role of increased endogenous GCs in the PS-induced decline of  epidermal AMP expression as well as a direct link between PS, via  increased endogenous GCs, and microbial pathogenesis. Yet these  studies did not address the source of the endogenous GCs that  mediate the negative effects of PS on cutaneous antimicrobial  defense. Increased GCs of HPA origin and/or generated within  the skin (which elaborates several HP mediators, including CRF,  proopiomelanocortin, and adrenocorticotropin) could, in part,  account forthese phenomena (27, 45, 55). Moreover, certain cell  types within skin appear capable of generating GCs (49, 50, 56).  Figure 8 PS increases the severity of cuta­ neous GAS infection. (A) Female 8­ to 10­wk­old Skh1/Hr mice were subjected to normal con ­ ditions or PS for 72 h, and then subsequently injected intrader­ mally with 4.8 x 108 CFU/ml GAS (n = 6 per group). Mice were then p hotographed daily for 4 d to monitor lesion size. (A) Repre­ sentative lesions at day 4 from nonstressed and PS mice. ( B) Lesion size (mean ± SEM) was calculated ± SEM for day 1 and day 4 lesions. *P < 0.05 versus nonstressed. (C) Representative lesions of PS mice (n = 5–6 per group) immediately prior to and 72 h after IP injection with either vehicle or RU­486 (6 mg/kg). After 72 h of PS or nonstressed conditions, mice were injected intradermally with 4.8 x 108 CFU/ ml GAS. A representative photo­ graph of day 4 lesions from each group is shown. (D) Lesion size (mean ± SEM) was calculated for day 4 lesions. †P < 0.05 versus PS and RU­486; #P < 0.05 versus PS and vehicle. The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  3345 research article (39), addition of exogenous lipids to endogenous lipid equivalents  could allow additional AMPs to be loaded into nascent LBs. Our  immunoelectron-microscopic results support this scheme, because  exogenous lipids clearly enhanced deposition of mBD3, but not  CRAMP, within LBs in the face of ongoing PS. Not only endogenous lipids (64), but also both hBD2 and the hCAP product LL-37,  are copackaged within epidermal LBs (37, 38) and then cosecreted  into the SC interstices (65). Our present results show that their  murine homologs mBD3 and CRAMP were also assembled within  epidermal LBs. Thus, the PS- and GC-induced downregulation of  mBD3 expression appears to reflect a prior diminution in epidermal lipid synthesis and/or LB production (Figure 9). One or more additional posttranscriptional mechanisms could  contribute to the PS-induced decline in mBD3 protein. While physical abrogation of the epidermal permeability barrier function typically stimulates generation of IL-1α and other primary cytokines  (66, 67), topical GCs instead decrease epidermal IL-1α and TNF-α  expression (33). Thus, a PS- or GC-induced decline in cytokine signaling (33) could contribute to reduced mBD2 expression. Prior  work has similarly suggested that a decline in primary cytokine  production contributes to PS-induced delays in cutaneous wound  healing (9–12, 22). Regardless of specific regulatory mechanisms,  our studies suggest that exogenous physiologic lipids could benefit not only epidermal permeability barrier function in the face of  PS or GCs (33, 68), but also cutaneous antimicrobial defense. The  common effects of PS and GCs on epidermal function and AMP  expression also support the putative link between the permeability and antimicrobial barriers in epidermis (35, 36). If operative  in other epithelia, PS-induced suppression of AMPs via increased  endogenous GCs could also explain the frequency and severity of  infections in extraepidermal tissues of patients subjected to PS    (1–10, 35, 36). Indeed, we show here that PS downregulated AMPs  in pilosebaceous structures, consistent with a microbial cause for  the observation that acne vulgaris flares with increased PS (49).  It is well known that PS adversely affects epithelial structure and  function in gastrointestinal epithelia (2–4, 69); AMPs in these epithelia may be important not only for antimicrobial defense, but  also for structural integrity (i.e., for the permeability barriers in  several extracutaneous epithelia; refs. 69–75). Thus, it is likely,  although not yet proven, that PS could abrogate AMP production  in parallel with its ability to compromise extracutaneous epithelial  barriers, as shown here for epidermis and pilosebaceous structures.  If these speculations can be validated, systematic therapy with CRF  or GCr inhibitors and/or targeted lipid replacement could improve  clinical outcomes in these settings. Methods Murine stress models Female hairless control mice (Skh1/Hr) and hairless Skh1 adrenalectomized mice were purchased from Charles River Laboratories and studied  between 7 and 9 wk of age. All animal experiments described in this study  were conducted in accordance with accepted standards of humane animal care, under protocols approved by the local animal research committee at San Francisco VA Medical Center. Prior to beginning experiments,  cohorts of 3 animals each were kept in separate cages for at least 7 d. For  the PS group, groups of 6 animals at a time (2 cohorts) were transferred  to a 12.5-cm-diameter, 12.5-cm-high, transparent glass jar and exposed to  continuous visible light and radio noise for 72 h. Additional groups of PS  animals were injected intraperitoneally with either RU-486 antalarmin in  Figure 9 Divergent mechanisms for PS­induced downregulation of epidermal CRAMP and mBD3. Thus, GCs of HPA origin and/or originating within the cutaneous  neuroendocrine system could mediate the PS-induced responses  described herein. While these results provide mechanistic insights into PS-related alterations in antimicrobial defense, they also provide a likely  pathomechanism for the increased risk of cutaneous (and extracutaneous) infections during PS (13, 15, 18, 20, 24) as well as  both systemic and topical GC therapy (47, 48, 57, 58). It should  be noted, however, that PS or GC therapy could increase the risk  of  cutaneous  infections  by  other,  unrelated  mechanisms;  for  example, GCs decrease epidermal dendritic cell function (59, 60),  another important participant in cutaneous innate immunity,  and also decrease epidermal primary cytokine levels (33), which  could influence antimicrobial defense by a variety of downstream  mechanisms. Indeed, primary cytokines regulate hBD2 expression  at a transcriptional level via NFκB and AP-1 sites on the hBD2 promoter (61), and they increase hBD2 bioavailability by stimulating  accumulation of nascent peptides within epidermal LB (37). Whereas the effects of GCs (and presumably, therefore, of PS) on  CRAMP protein expression can be attributed to downregulation at  the mRNA level, PS and systemic GCs instead appear to decrease  mBD3 expression at the protein level alone (Figure 9). The ability  of topical physiologic lipids to partially override the PS-induced  downregulation of mBD3 (whose mRNA levels do not change with  PS) supports the concept that PS downregulates AMPs through  increased endogenous GCs, which in turn inhibits epidermal lipid  synthesis and/or LB formation (34). Yet adrenalectomized mice  demonstrated an increase in mBD3 mRNA expression, while clobetasol treatment downregulated mRNA levels of mBD3. These  divergent results can best be explained by the sustained decrease  in GC production that occurs in adrenalectomized mice. Conversely, the superpotent topical steroid clobetasol likely has more  profound effects on epidermal structure and metabolism than  systemic GCs. Thus, the decrease in mRNA levels for mBD3 in  clobetasol-treated mice likely reflects a global decrease in protein  synthesis. Although the precise subcellular mechanisms whereby  exogenous lipids appear to override the negative effects of PS or  GC therapy on mBD3 remain uncertain, exogenous physiologic  lipids have previously been shown to traverse the SC, targeting the  trans-Golgi apparatus of cells in the outer nucleated layers where  LBs are assembled (62, 63). Because packaging of protein cargo  within LBs is dependent on prior or concurrent lipid deposition  3346 The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007 research article propylene glycol/ethanol (7:3 v/v) or vehicle alone 1 h prior to stress onset  and every 24 h thereafter for 72 h. RU-486 (mifepristone; Sigma-Aldrich)  and antalarmin hydrochloride (Sigma-Aldrich) were administered at doses  of 6 mg/kg (1 mg/ml propylene glycol) and 20 mg/kg, respectively. Additional mice were kept in ordinary cages (3 per cage), without continuous  light and sound, and injected in some cases with vehicle as described above.  All experimental results were replicated 2–3 times in separate experiments,  and the results shown in the figures are representative of the results in replicate experiments. All mice were maintained in a temperature- and humidity-controlled room and given standard laboratory food and tap water ad  libitum. There were no differences in body weights in the PS versus control  groups during the course of these experiments. Briefly, epidermis was separated from mouse skin after incubations of    full-thickness pieces of flank skin in 10 mM EDTA in PBS at 37°C for  2 h. Extractions were performed in an acidic buffer (30% acetonitrile, 0.1%  formic acid; pH <3); extracts were homogenized on ice and centrifuged at  17,530 g for 30 min at 4°C, and then the supernatants were re-centrifuged  for 15 min prior to protein fractionation. An equal amount of extracted  protein in NuPAGE sample buffer in water was heated at 85°C, without  reducing agents, followed by loading of equal amounts of samples from  each experimental group onto 10% tricine gels (Invitrogen), using β-actin  as an internal standard. After electrophoresis, proteins were transferred  from gels onto PVDF membranes and electrophoresed for 1 h in tricine/ glycine transfer buffer, followed by immunoblotting with the rabbit antimouse mBD3 antibody (Alpha Diagnostics). Antibody binding to mBD3  was detected with the Western-Breeze chemiluminescence kit, following  the manufacturer’s protocol (Invitrogen). GC administration and blockade Female hairless mice (Skh1/Hr; 7–8 wk of age), as described above, were  used for GC systemic and topical administration. Clobetasol 0.05% in propylene glycol/ethanol (7:3 v/v) vehicle was applied twice daily for 3 d to the  flanks of hairless mice. Another group of littermates received vehicle alone  at the same frequency. Systemic GC was administered by injecting each  mouse intraperitoneally with 9 μg dexamethasone (450 μg/kg) in propylene glycol/ethanol (7:3 v/v) vehicle or vehicle alone once daily for 3 d, as  described previously (31, 33). Dexamethasone (10 nM) or ethanol vehicle  was added to preconfluent (80%–90%), second-passage, cultured human  keratinocytes. mRNA was harvested 18 h later for quantitation of hBD2  and LL-37 by RT-PCR (see below). Morphologic studies Immunofluorescence. Skin biopsy samples were taken (n = 3 per group) and  snap-frozen in liquid nitrogen in a tissue-embedding medium. Frozen  sections (8  μm) were soaked in acetone for 10 min, washed in PBS, and  blocked with 4% BSA and 0.05% cold fish gelatin in PBS for 30 min. Slides  were then incubated overnight at 4°C with CRAMP or mBD3 (Alpha Diagnostic) primary antibodies, followed by incubation with FITC-conjugated  goat anti-rabbit secondary antibody for 40 min at room temperature.  Slides were counterstained with propidium iodide and visualized on a  Leica TCS-SP confocal microscope. Controls without primary antibodies  showed no immunolabeling, and skin sections of CRAMP knockout mice  served as controls. Electron microscopy. Skin biopsies from PS and nonstressed mice were  minced to less than 0.5 mm3, fixed in modified Karnovsky’s fixative overnight, and postfixed in 0.5% RuO4 and 2% OsO4 containing 1.5% potassium ferrocyanide (81). After postfixation, all samples were dehydrated in  graded ethanol solutions and embedded in an Epon-epoxy mixture. Ultrathin sections were examined, with or without further lead citrate contrasting, using a Zeiss 10A electron microscope operated at 60 kV. Immunoelectron microscopy. Skin biopsies for immunoelectron microscopy were cut into 0.5-mm3 pieces and microwave-fixed for 2.5 min in  0.1 M cacodylate buffer (pH 7.4, containing 0.1% sodium periodate, 0.6%    L-lysine, and CaCl2) at 37°C. Samples were postfixed in reduced osmium  tetroxide (2% OsO4 and 1.5% potassium ferrocyanide in 0.1 M cacodylate  buffer, pH 7.4) for 2.5 min in the microwave at 37°C. Samples were then  washed 3 times in double-distilled water; postfixed for 1 h in 2% aqueous  uranyl acetate at 4°C; dehydrated in graded ethanol solutions; transferred  first to a 1:1, then a 2:1, mixture of LR White resin (EMS) in 100% ethanol  for 15 min each; and finally infiltrated in 100% LR White for 2 h (all steps  at 4°C). Polymerization was carried out at 40°C under a vacuum for 2 d.  Ultrathin sections were collected on Formvar-coated nickel grids. All immunolabeling steps were carried out at room temperature. Nonspecific binding sites were blocked with 5% BSA, 5% normal goat serum,  and 0.1% cold-water fish gelatin in PBS for 20 min, after which grids were  washed 3 times for 5 min each in incubation buffer (0.1% Aurion BSA-c;  EMS; in PBS). Primary antibodies (rabbit anti-CRAMP and rabbit antimBD3) were used at a 1:10 dilution in incubation buffer for 1 h. After  3 washes for 5 min each with incubation buffer, sections were incubated with goat anti-rabbit IgG, conjugated to 10 nm colloidal gold (Ted  Pella Inc.) for 1 h. After secondary immunolabeling, grids were washed  6 times with incubation buffer followed by 3 washes with PBS, fixed in  2% glutaraldehyde in PBS for 5 min, followed by a final water wash for  30 s. Sections were examined by electron microscopy after contrasting  with both 2% aqueous uranyl acetate and 0.6% lead citrate. Quantitation  3347 GAS infection GAS infection was performed as previously described (76). Briefly, the dorsal skin of PS and nonstressed Skh1/Hr mice was injected with 50 μl of a  midlogarithmic growth phase (A600 = 0.8; 4.8 × 108 CFU/ml) of GAS NZ131  conjugated with 50 μl of sterile Cytodex beads, which acts as a carrier, or  Cytodex beads alone (n = 6 per group). Lesions were photographed daily for  7 d, and lesion size was quantitated in digital micrographs. Tissue preparation, protein, and RNA isolation Skin samples were obtained following 3 d of topical or systemic GC treatment, or 72 h PS with or without RU-486 or antalarmin. Epidermis from  all groups was obtained by EDTA separation. Total RNA was extracted with  a commercially available kit (RNeasy Mini RNA isolation kit; QIAGEN) in  accordance with the manufacturer’s instructions. RNA solution (50 μl) was  reverse-transcribed to cDNA as previously described (77). Real-time quantitative PCR was performed on an ABI 7900 machine using SYBR Green  detection as previously described for the mBD3, murine cathelicidin, and  18S RNA (internal control) measurements (40, 41). The SYBR Green kit  was purchased from Applied Biosystems. Primer sequences were: mBD3  forward, ATTTCTCCTGGTGCTCGTGT; reverse, GGAACTCCACAACTGCCAAT;  18S  RNA  forward,  GTAACCCGTTGAACCCCATT;  reverse,  CCATCCAATCGGTAGTAGCG. The mBD3 and 18S RNA PCR primers  were synthesized by Biosearch Technologies. Standard reaction volumes  were 20 μl with 250 ng cDNA and 125 nM hBD2 and mBD3, 500 nM 18S  RNA, or 1 μM final concentration of the cathelicidin primers. Initial steps  of RT-PCR were 2 min at 50°C, 10-min hold at 95°C, and 40 cycles of a 15-s  melt at 95°C followed by a 300-s annealing/extension at 60°C. All reactions were performed in triplicate. The threshold for threshold cycle (Ct)  analysis of all samples was set at 0.50 relative fluorescence units. Quantitative PCR data were analyzed using the 2–ΔΔCt method (78, 79). Western immunoblotting For Western blotting, a method was employed for extraction of low–molecular weight, hydrophobic, cationic peptides, as described previously (80).  The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  research article of immunolabeling was carried out in coded, randomized micrographs    (n ≥ 10 each) from 4 different samples. samples for Westernblotting. We gratefully acknowledge the excellent editorial assistance of Joan Wakefield and Jerelyn Magnusson. Received for publication February 6, 2007, and accepted in revised  form July 16, 2007. Address correspondence to: Peter M. Elias, Dermatology Service  (190), VA Medical Center, 4150 Clement Street, San Francisco, California 94121, USA. Phone: (415) 750-2091; Fax: (415) 751-3927;  E-mail: eliasp@derm.ucsf.edu. Portions of this work were presented at the annual meeting of the  Society for Investigative Dermatology in Philadelphia, Pennsylvania, USA, May 3–6, 2006, and published in abstract form. Regul. Integr. Comp. Physiol. 291:R1657–R1662.   33. Kao, J.S., et al. 2003. Short-term glucocorticoid  treatment  compromises  both  permeability  barrier homeostasis and stratum corneum integrity:  inhibition of epidermal lipid synthesis accounts  for functional abnormalities.  J. Invest. Dermatol.  120:456–464.   34. Choi, E.H., et al. 2005. Mechanisms by which psychologic stress alters cutaneous permeability barrier homeostasis and stratum corneum integrity.   J. Invest. Dermatol. 124:587–595.   35. Elias,  P.M.,  and  Choi,  E.H.  2005.  Interactions  among stratum corneum defensive functions. Exp. Dermatol. 14:719–726.   36. Elias,  P.M.  2005.  Stratum  corneum  defensive  functions: an integrated view.  J. Invest. Dermatol.  125:183–200.   37. Oren, A., Ganz, T., Liu, L., and Meerloo, T. 2003. In  human epidermis, beta-defensin 2 is packaged in  lamellar bodies. Exp. Mol. Pathol. 74:180–182.   38. Braff, M.H., Di Nardo, A., and Gallo, R.L. 2005.  Keratinocytes  store  the  antimicrobial  peptide  cathelicidin in lamellar bodies.  J. Invest. Dermatol.  124:394–400.   39. Rassner, U., Feingold, K.R., Crumrine, D.A., and  Elias, P.M. 1999. Coordinate assembly of lipids  and enzyme proteins into epidermal lamellar bodies. Tissue Cell. 31:489–498.   40. Ganz, T. 2003. Defensins: antimicrobial peptides of  innate immunity. Nat. Rev. Immunol. 3:710–720.   41. Braff, M.H., and Gallo, R.L. 2006. Antimicrobial peptides: an essential component of the skin defensive  barrier. Curr. Top. Microbiol. Immunol. 306:91–110.   42. Nizet, V., et al. 2001. Innate antimicrobial peptide  protects the skin from invasive bacterial infection.  Nature. 414:454–457.   43. O’Sullivan, R.L., Lipper, G., and Lerner, E.A. 1998.  The neuro-immuno-cutaneous-endocrine network:  relationship  of  mind  and  skin.  Arch. Dermatol.  134:1431–1435.   44. Paus, R., Theoharides, T.C., and Arck, P.C. 2006.  Neuroimmunoendocrine circuitry of the ‘brainskin connection’. Trends Immunol. 27:32–39.   45. Slominski, A., et al. 2006. Corticotropin releasing  hormone and the skin. Front. Biosci. 11:2230–2248.   46. Ito, N., et al. 2005. Human hair follicles display a  functional equivalent of the hypothalamic-pituitary-adrenal axis and synthesize cortisol. FASEB J.  19:1332–1334.   47. Hengge,  U.R.,  Ruzicka,  T.,  Schwartz,  R.A.,  and  Cork, M.J. 2006. Adverse effects of topical glucocorticosteroids. J. Am. Acad. Dermatol. 54:1–15; quiz  16–18.   48. Lionakis, M.S., and Kontoyiannis, D.P. 2003. Glucocorticoids and invasive fungal infections. Lancet.  362:1828–1838.   49. Slominski, A., Zbytek, B., Semak, I., Sweatman, T.,  and Wortsman, J. 2005. CRH stimulates POMC  activity and corticosterone production in dermal  Statistics Data were expressed as mean ± SEM. Statistical analyses were performed  using paired and unpaired Student’s  t tests. A P value less than 0.05 was  considered significant. Acknowledgments These  studies  were  supported  by  NIH  grants  AR19098,  AR39448(PP), and AI059311 and by the Medical Research Service,  Department of Veterans Affairs. K.M. Aberg was supported by an  NIH postdoctoral fellowship (AR07175-28). Jens Schröder (University of Kiel, Kiel, Germany) provided invaluable advice in preparing    1. Glaser, R. 2005. Stress-associated immune dysregulation and its importance for human health: a personal history of psychoneuroimmunology.  Brain Behav. Immun. 19:3–11.   2. Meddings, J.B., and Swain, M.G. 2000. Environmental stress-induced gastrointestinal permeability is mediated by endogenous glucocorticoids in  the rat. Gastroenterology. 119:1019–1028.   3. Mawdsley, J.E., and Rampton, D.S. 2005. Psychological stress in IBD: new insights into pathogenic  and therapeutic implications. Gut. 54:1481–1491.   4. Jones, M.P. 2006. The role of psychosocial factors  in peptic ulcer disease: beyond Helicobacter pylori  and NSAIDs. J. Psychosom. Res. 60:407–412.   5. Strike, P.C., and Steptoe, A. 2004. Psychosocial factors in the development of coronary artery disease.  Prog. Cardiovasc. Dis. 46:337–347.   6. Rozanski, A., Blumenthal, J.A., Davidson, K.W.,  Saab, P.G., and Kubzansky, L. 2005. The epidemiology, pathophysiology, and management of psychosocial risk factors in cardiac practice: the emerging  field of behavioral cardiology.  J. Am. Coll. Cardiol.  45:637–651.   7. Marucha, P.T., Kiecolt-Glaser, J.K., and Favagehi,  M. 1998. Mucosal wound healing is impaired by  examination stress. Psychosom. Med. 60:362–365.   8. Spiegel, D. 1999. Healing words: emotional expression and disease outcome. JAMA. 281:1328–1329.   9. Broadbent, E., Petrie, K.J., Alley, P.G., and Booth, R.J.  2003. Psychological stress impairs early wound repair  following surgery. Psychosom. Med. 65:865–869.   10. Ebrecht, M., et al. 2004. Perceived stress and cortisol levels predict speed of wound healing in healthy  male adults. Psychoneuroendocrinology. 29:798–809.   11. Horan, M.P., et al. 2005. Impaired wound contraction  and  delayed  myofibroblast  differentiation  in  restraint-stressed  mice.  Brain Behav. Immun.  19:207–216.   12. Kiecolt-Glaser,  J.K.,  et  al.  2005.  Hostile  marital  interactions, proinflammatory cytokine production,  and  wound  healing.  Arch. Gen. Psychiatry.  62:1377–1384.   13. Ben-Nathan, D., Lustig, S., and Feuerstein, G. 1989.  The influence of cold or isolation stress on neuroinvasiveness and virulence of an attenuated variant  of West Nile virus. Arch. Virol. 109:1–10.   14. Rein, M. 2000. Stress and genital herpes recurrences in women. JAMA. 283:1394.   15. Mohren, D.C., Swaen, G.M., van Amelsvoort, L.G.,  Borm, P.J., and Galama, J.M. 2003. Job insecurity  as a risk factor for common infections and health  complaints. J. Occup. Environ. Med. 45:123–129.   16. Ortiz, G.C., Sheridan, J.F., and Marucha, P.T. 2003.  Stress-induced changes in pathophysiology and  interferon gene expression during primary HSV-1  infection. Brain Behav. Immun. 17:329–338.   17. Pereira, D.B., et al. 2003. Stress as a predictor of  symptomatic  genital  herpes virus  recurrence  in  women  with  human  immunodeficiency  virus.   3348 J. Psychosom. Res. 54:237–244.   18. Hunzeker, J., Padgett, D.A., Sheridan, P.A., Dhabhar, F.S., and Sheridan, J.F. 2004. Modulation of  natural killer cell activity by restraint stress during  an influenza A/PR8 infection in mice. Brain Behav. Immun. 18:526–535.   19. Kopnisky,  K.L.,  Stoff,  D.M.,  and  Rausch,  D.M.  2004. Workshop report: the effects of psychological variables on the progression of HIV-1 disease.  Brain Behav. Immun. 18:246–261.   20. Gomez-Merino, D., et al. 2005. Effects of combined  stress during intense training on cellular immunity, hormones and respiratory infections. Neuroimmunomodulation. 12:164–172.   21. Johnson, R.R., et al. 2006. Social stress alters the  severity and onset of the chronic phase of Theiler’s  virus infection. J. Neuroimmunol. 175:39–51.   22. Glaser, R., et al. 1999. Stress-related changes in  proinflammatory cytokine production in wounds.  Arch. Gen. Psychiatry. 56:450–456.   23. Brogden, K.A., Guthmiller, J.M., Salzet, M., and  Zasloff, M. 2005. The nervous system and innate  immunity:  the  neuropeptide  connection.  Nat. Immunol. 6:558–564.   24. Kiank, C., et al. 2006. Stress susceptibility predicts  the severity of immune depression and the failure to combat bacterial infections in chronically  stressed mice. Brain Behav. Immun. 20:359–368.   25. Cacioppo, J.T., et al. 2002. Autonomic and glucocorticoid associations with the steady-state expression  of  latent  Epstein-Barr  virus.  Horm. Behav.  42:32–41.   26. Slominski, A.T., et al. 1999. Cutaneous expression  of CRH and CRH-R. Is there a “skin stress response  system?” Ann. N. Y. Acad. Sci. 885:287–311.   27. Slominski, A., Wortsman, J., Luger, T., Paus, R.,  and  Solomon,  S.  2000.  Corticotropin  releasing  hormone and proopiomelanocortin involvement  in the cutaneous response to stress.  Physiol. Rev.  80:979–1020.   28. Denda, M., Tsuchiya, T., Hosoi, J., and Koyama, J.  1998. Immobilization-induced and crowded environment-induced stress delay barrier recovery in  murine skin. Br. J. Dermatol. 138:780–785.   29. Altemus, M., Rao, B., Dhabhar, F.S., Ding, W., and  Granstein, R.D. 2001. Stress-induced changes in  skin barrier function in healthy women.  J. Invest. Dermatol. 117:309–317.   30. Garg, A., et al. 2001. Psychological stress perturbs  epidermal permeability barrier homeostasis: implications for the pathogenesis of stress-associated  skin disorders. Arch. Dermatol. 137:53–59.   31. Denda, M., Tsuchiya, T., Elias, P.M., and Feingold,  K.R. 2000. Stress alters cutaneous permeability barrier homeostasis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278:R367–R372.   32. Choi, E.H., et al. 2006. Glucocorticoid blockade  reverses psychological stress-induced abnormalities  in epidermal structure and function. Am. J. Physiol. The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007 research article fibroblasts. J. Neuroimmunol. 162:97–102.   50. Slominski, A., et al. 2005. CRH stimulation of corticosteroids production in melanocytes is mediated  by  ACTH.  Am. J. Physiol. Endocrinol. Metab.  288:E701–E706.   51. Simmaco,  M.,  et  al.  1997.  Effect  of  glucocorti coids on the synthesis of antimicrobial peptides in  amphibian skin. FEBS Lett. 416:273–275.   52. Chiu, A., Chon, S.Y., and Kimball, A.B. 2003. The  response of skin disease to stress: changes in the  severity of acne vulgaris as affected by examination  stress. Arch. Dermatol. 139:897–900.   53. Culhane, J.F., Rauh, V., McCollum, K.F., Elo, I.T.,  and Hogan, V. 2002. Exposure to chronic stress  and ethnic differences in rates of bacterial vaginosis among pregnant women. Am. J. Obstet. Gynecol.  187:1272–1276.   54. de Jongh, G.J., et al. 2005. High expression levels  of keratinocyte antimicrobial proteins in psoriasis  compared with atopic dermatitis. J. Invest. Dermatol.  125:1163–1173.   55. Slominski, A., Wortsman, J., Tuckey, R.C., and Paus,  R. 2007. Differential expression of HPA axis homolog  in the skin. Mol. Cell. Endocrinol. 265–266:143–149.   56. Slominski,  A.,  et  al.  2004.  A  novel  pathway  for  sequential transformation of 7-dehydrocholesterol  and expression of the P450scc system in mammalian skin. Eur. J. Biochem. 271:4178–4188.   57. Kang, I., and Park, S.H. 2003. Infectious complications in SLE after immunosuppressive therapies.  Curr. Opin. Rheumatol. 15:528–534.   58. Encke,  J.,  Uhl,  W.,  Stremmel,  W.,  and  Sauer,  P.  2004.  Immunosuppression  and  modulation  in  liver  transplantation.  Nephrol. Dial. Transplant.  19(Suppl. 4):iv22–iv25.   59. Hoetzenecker, W., et al. 2004. Corticosteroids but  not pimecrolimus affect viability, maturation and  immune function of murine epidermal Langerhans  cells. J. Invest. Dermatol. 122:673–684.   60. Krummen, M.B., et al. 2006. Effect of pimecrolimus  vs. corticosteroids on murine bone marrow-derived  dendritic cell differentiation, maturation and function. Exp. Dermatol. 15:43–50.   61. Wehkamp, K., Schwichtenberg, L., Schroder, J.M.,  and Harder, J. 2006. Pseudomonas aeruginosa- and  IL-1beta-mediated induction of human beta-defensin-2 in keratinocytes is controlled by NF-kappaB  and AP-1. J. Invest. Dermatol. 126:121–127.   62. Mao-Qiang,  M.,  Feingold,  K.R.,  and  Elias,  P.M.  1993. Exogenous lipids influence permeability barrier recovery in acetone-treated murine skin. Arch. Dermatol. 129:728–738.   63. Mao-Qiang, M., Brown, B.E., Wu-Pong, S., Feingold,  K.R., and Elias, P.M. 1995. Exogenous nonphysiologic vs physiologic lipids. Divergent mechanisms  for correction of permeability barrier dysfunction.  Arch. Dermatol. 131:809–816.   64. Feingold, K.R. 1991. The regulation and role of epidermal lipid synthesis. Adv. Lipid Res. 24:57–82.   65. Huh,  W.K.,  et  al.  2002.  Dynamic  alteration  of  human  beta-defensin  2  localization  from  cytoplasm to intercellular space in psoriatic skin. J. Mol. Med. 80:678–684.   66. Wood, L.C., Jackson, S.M., Elias, P.M., Grunfeld, C.,  and Feingold, K.R. 1992. Cutaneous barrier perturbation stimulates cytokine production in the  epidermis of mice. J. Clin. Invest. 90:482–487.   67. Nickoloff, B.J., and Naidu, Y. 1994. Perturbation  of epidermal barrier function correlates with initiation of cytokine cascade in human skin.  J. Am. Acad. Dermatol. 30:535–546.   68. Man, M.Q., et al. 2006. Basis for improved permeability barrier homeostasis induced by PPAR and  LXR activators: liposensors stimulate lipid synthesis, lamellar body secretion, and post-secretory  lipid processing. J. Invest. Dermatol. 126:386–392.   69. Levy, R.L., et al. 2006. Psychosocial aspects of the  functional gastrointestinal disorders. Gastroenterology. 130:1447–1458.   70. Taupin, D., and Podolsky, D.K. 2003. Trefoil factors: initiators of mucosal healing.  Nat. Rev. Mol. Cell Biol. 4:721–732.   71. Cameron,  H.L.,  and  Perdue,  M.H.  2005.  Stress  impairs  murine  intestinal  barrier  function:  improvement by glucagon-like peptide-2.  J. Pharmacol. Exp. Ther. 314:214–220.   72. Shaykhiev, R., et al. 2005. Human endogenous antibiotic LL-37 stimulates airway epithelial cell proliferation and wound closure. Am. J. Physiol. Lung Cell. Mol. Physiol. 289:L842–L848.   73. Yang, Y.H., et al. 2006. The cationic host defense  peptide rCRAMP promotes gastric ulcer healing in  rats. J. Pharmacol. Exp. Ther. 318:547–554.   74. Heilborn, J.D., et al. 2003. The cathelicidin antimicrobial peptide LL-37 is involved in re-epithelialization of human skin wounds and is lacking  in  chronic  ulcer  epithelium.  J. Invest. Dermatol.  120:379–389.   75. Strober,  W.  2006.  Immunology.  Unraveling  gut  inflammation. Science. 313:1052–1054.   76. Betschel, S.D., Borgia, S.M., Barg, N.L., Low, D.E., and  De Azavedo, J.C. 1998. Reduced virulence of group  A streptococcal Tn916 mutants that do not produce  streptolysin S. Infect. Immun. 66:1671–1679.   77. Tirmenstein,  M.A.,  Nicholls-Grzemski,  F.A.,  Schmittgen, T.D., Zakrajsek, B.A., and Fariss, M.W.  2000. Characterization of nitric oxide production  following isolation of rat hepatocytes. Toxicol. Sci.  53:56–62.   78. Winer, J., Jung, C.K., Shackel, I., and Williams, P.M.  1999.  Development  and  validation  of  real-time  quantitative reverse transcriptase-polymerase chain  reaction for monitoring gene expression in cardiac  myocytes in vitro. Anal. Biochem. 270:41–49.   79. Schmittgen, T.D., et al. 2000. Quantitative reverse  transcription-polymerase chain reaction to study  mRNA decay: comparison of endpoint and realtime methods. Anal. Biochem. 285:194–204.   80. Schroder, J.M. 2001. Isolation and purification of  chemokines from natural sources.  Mol. Biotechnol.  18:71–77.   81. Hou,  S.Y.,  et  al.  1991.  Membrane  structures  in  normal and essential fatty acid-deficient stratum  corneum: characterization by ruthenium tetroxide  staining and x-ray diffraction.  J. Invest. Dermatol.  96:215–223. The Journal of Clinical Investigation      http://www.jci.org      Volume 117      Number 11      November 2007  3349 ...
View Full Document

Ask a homework question - tutors are online