CH 10---DNA&RNA - DNA, RNA & Protein DNA, RNA &...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: DNA, RNA & Protein DNA, RNA & Protein DNA Replication DNA Replication How does How does this Become… AACTGCACCGTGCCATACGAGC….. AACTGCACCGTGCCATACGAGC…. Transcription and Translation (How a gene becomes a protein) Transcription Transcription Copying from one medium to another. For example, a written copy from an oral dictation (DNA RNA) Translation Changing into another language (RNA Protein) RNA RNA Ribonucleic acid Uses Uracil instead of Thymine (C pairs with G, A pairs with U) 3 types: mRNA – messenger RNA tRNA – transfer RNA rRNA – ribosomal RNA Transcription Transcription Translation Translation Viruses Viruses ...
View Full Document

This note was uploaded on 11/17/2010 for the course BIO bio 101 taught by Professor C during the Spring '05 term at Diablo Valley College.

Ask a homework question - tutors are online