{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

BIO 221 HW2 - susceptibility to colon cancer The probe...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
2. -35 -10 +1 5’-TAGTGTA TTGACATGATAGAAGCACTCTTAC TATAATCTCAATAGCTACG-3’ 3’-ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC-5’ Template Strand RNA polymerase 3. 5’ GGCATGTCAGGGCCTTACAAACATAATG 3’ Template strand 3’ CCGUACAGUCCCGGTTUGUUUGUAUUAC 5’ Peptide sequence 4. a. (co-repressor present and activator binds) (gene is expressed) _______________________//____________________ A b. (co-repressor present and bound by protein causing change to binding site) ( gene is not expressed) ______________________//_______________________ A c.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
(inducer present and binds to repressor and changes the conformation and unable to bind to operator and gene is not expressed) _________________________//________________________ A 5. Yes the radioactive nucleic acid is added and binds to the DNA segment, in this case the gene that enhances
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: susceptibility to colon cancer. The probe enhances the color of the band in the agarose gel and patient 2 does have an enhanced band. 6. a. Cytokines= allow chemotaxis (recruit) to site of infection b. TLRs= produce cytokines which induce pain and in turn increase blood flow, produce adhesion molecules, make capillary walls porous, and then swelling c. interferon alpha= proteins that respond to pathogens and communicate to cells to trigger protective defenses d. MHC-II= mounts foreign protein from phagolysosome and recruits T-helper cells to activate the adaptive immune response. e. Dendritic cells= recognize antigens and engulf the infected, dead cells f. B-lymphocytes= make antibodies against antigens...
View Full Document

{[ snackBarMessage ]}