Stats254_Ch1_Introduction

Stats254_Ch1_Introduction - Stats M254 Statistical Methods...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
1 1 Chapter 1 Introduction and Data Stats M254 Statistical Methods in Computational Biology 2 Outline of this chapter Introduction to molecular biology DNA, gene, RNA, protein, central dogma Typical data: gene expression, sequence, ChIP-seq/chip
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 3 DNA DNA (Deoxyribonucleic acid) is a molecule to store genetic information of a living organism. DNA consists of two polymers made from four types of nucleotides: adenine (A), guanine (G), cytosine (C) and thymine (T). Purines: A, G; Pyrimidines: C, T Two polymers are complementary to each other and from a double-helix structure 5’-ACCGTTCGACGGTAA-3’ ||||||||||||||| 3’-TGGCAAGCTGCCATT-5’ 4 Chromosome
Background image of page 2
3 5 Gene Gene Gene Gene Gene Gene 6 Central Dogma
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4 7 Data type 1: Gene expression data Expression A B C A B C A B C No Expression X Y Z X Y Z X Y Z X Y Z Temporally Spatially 8 Principle of gene expression microarray
Background image of page 4
5 9 Source: Affymetrix Inc. 10 Source: Affymetrix Inc.
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
6 11 Source: Affymetrix Inc. 12 Gene expression data matrix
Background image of page 6
7 13 Data type 2: Regulatory sequences TF1 TF2 Transcription factors (TF): TF1 TF2 TTATGTAACCTGCACTTACTA CCACCCAC AACA TAATAAAAT CTAAACCACTGAATGAAATACAAAATCTATGTATGA. .. TF1
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/24/2010 for the course STAT 201a taught by Professor Wu during the Spring '10 term at Pasadena City College.

Page1 / 11

Stats254_Ch1_Introduction - Stats M254 Statistical Methods...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online