Exam%2B1--Fall%2B2003

Exam%2B1--Fall%2B2003 - Bio305 Genetics Fall 2003 Your Name

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Bio305 Genetics Fall 2003 Your Name _______________________________________ Signature _________________________________________ Student number ___________________________________ Section Number: __________________________________ __________________________________ Graduate Student Instructor: Please write your name on every page. For the multiple choice questions, CIRCLE THE SINGLE BEST RESPONSE ON THE BOTTOM OF THIS PAGE. You might also want to circle the correct answer on your examination sheet. For the written problems. WRITE YOUR ANSWERS USING A NON-ERASABLE PEN. OTHERWISE WE WILL NOT BE ABLE TO CONSIDER ANY REQUESTS FOR REGRADING. SHOW YOUR CALCUALTIONS, and EXPLAIN YOUR WORK CLEARLY AND NEATLY. Otherwise, we will not be able to grant partial credit. Blank paper has been attached to the exam to give you room to work. WRITE YOUR FINAL ANSWERS IN THE INDICATED SPACE ON YOUR EXAM. (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) 1-20 a a a a a a a a a a b b b b b b b b b b c c c c c c c c c c d d d d d d d d d d e e e e e e e e e e f f f f f f f f f f gh g g g g h h h hi gh gh gh 22 (11) (12) (13) (14) (15) (16) (17) (18) (19) (20) 23 a a a a a a a a a a b b b b b b b b b b c c c c c c c c c c d d d d d d d d d d e e e e e e e e e e f f f f f f f f f f gh g gh gh gh gh ghi g gh g 25 21 24 Bio305 Genetics Fall 2003 (1) Some codons in the genetic code were determined experimentally by the translation of random polymers. In a mixed copolymer experiment using 3/4 G and 1/4 C (in random order), which amino acid would be the most common in the resulting polypeptide chain? a.) ala d.) arg g.) lys b.) ile e.) gly h.) pro c.) thr f.) ser (2) The molecule 2-aminopurine is an analog of adenine that pairs with thymine. It also occasionally pairs with cytosine. What type of mutation will be induced by 2-aminopurine? a.) A-T to T-A transition d.) A-T to C-G transversion b.) A-T to T-A transversion e.) A-T to A-C mismatch c.) A-T to G-C transition f.) A-T to G-C frameshift (3) If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 5’-UCAGGACCUUAUGGACCAUUGCUGGGACCUUUAAAUGCUGUACCAUAGUUAAUGAUAGCCAUG-3’ a.) 16 e.) 5 b.) 14 f.) 15 c.) 10 g.) 9 d.) 13 h.) 7 (4) Approximately how many base pairs of DNA are wrapped around core histones? a.) 50 bp e.) 250 bp b.) 100 bp f.) 300 bp c.) 150 bp g.) 500 bp d.) 200 bp h.) 1000 bp (5) Which mutagenic agent most frequently induces thymine dimers? a.) ultraviolet light d.) alkylating agents g.) base analogs b.) postreplication repair e.) 5-Bromouracil h.) depurinating agents c.) ionizing radiation f.) intercalating agents (6) Spliceosomes remove what structures from primary transcripts? a.) exons d.) 7’-methyl cap h.) 3’ untranslated regions b.) introns e.) Poly(A) tails i.) thymine bases c.) LINES g.) 5’ untranslated regions Bio305 Genetics Fall 2003 (7) You have just sequenced both strands of a double-stranded DNA molecule. To inspect the potential amino acid coding content of this molecule, you conceptually translate the DNA. How many reading frames will you examine? a.) 1 b.) 2 c.) 3 d.) 4 e.) 5 f.) 6 (8) A double stranded DNA molecule is separated into its constituent strands, and the strands are separated in an ultracentrifuge. In one of the strands the base composition is 24 % A, 28 % T, 22 % G, and 26 % C. What is the base composition of the other strand? a.) 24 % A, 28 % T, 22 % G, and 26 % C c.) 25 % A, 25 % T, 25 % G, and 25 % C e.) 26 % A, 22 % T, 28 % G, and 24 % C g.) 28 % A, 28 % T, 22 % G, and 22 %C b.) 24 % A, 24 % T, 22 % G, and 23 % C d.) 22 % A, 26 % T, 24 % G, and 28 % C f.) 26 % A, 26 % T, 24 % G, and 24 % C h.) 28 % A, 24 % T, 26 % G, and 22 % C (9) The double-stranded DNA molecule of a newly discovered virus was found by electron microscopy to have a length of 34 mM. How many nucleotide pairs are present in one of these molecules? a.) 3,269 bp d.) 100,000 bp g.) 170,000 bp b.) 50,000 bp e.) 17,000 bp h.) 1,000,000 bp c.) 10,000 bp f.) 32,690 bp (10) Five nutritional mutants in Neurospora were independently isolated. They all require compound F to grow. Intermediate compounds in the biosynthesis of compound F are known and tested for their ability to support the growth of each mutant. The results are given in the table below, where “+” indicates growth and “-“ indicates no growth. Mutants 1 2 3 4 5 A + + + + B + + + Compound added C D + + + E F + + + + + Assuming a linear pathway, what is the order of the compounds A through F? a.) EDBCAF e.) EBDCAF b.) ECBADF f.) EABCDF c.) ECABDF g.) EDCBAF d.) EBCDAF h.) EADBCF Bio305 Genetics Fall 2003 (11) The virus SV40 contains 5200 base pairs. What is the linking number of the relaxed DNA molecule? a.) 500 e.) 153 b.) 1529 f.) 50 c.) 5,200 g.) 2,600 d.) 260 h.) 15,294 (12) Refer to the coding-strand DNA sequence below (the non-template strand). The first nucleotide of the sequence encodes the first nucleotide of a codon. 5’…AAATGGAAGAAATGGAATGCTGGATGAGTTTCG…3’ What mRNA sequence corresponds to this coding-strand DNA? a.) 5’…CGAAACTCATCCAGCATTCCATTTCTTCCAATT…3’ b.) 5’…CGAAACUCAUCCAGCAUUCCAUUUCUUCCAUUU…3’ c.) 5’…AAAUGGAAGAAAUGGAAUGCUGGAUGAGUUUCG …3’ d). 5’…GCUUUGAGUAGGUCGUAAGGUAAAGAAGGUAAA…3’ e.) 5’…AAATGGAAGAAATGGAATGCTGGATGAGTTTCG…3’ f.) 5’…ATGGAAGAAATGGAATGCTGGATGAGTTTCG…3’ g.) 5’…AUGGAAGAAAUGGAAUGCUGGAUGAGUUUCG…3’ (13) A specific nonsense mutation in the Sleepy gene, sleA, results in students falling asleep in class. Sequence analysis reveals that an arg codon (CGA) was mutated to a UGA stop codon (a single nucleotide change). A nonsense suppressor in a Leu tRNA results in suppression of this nonsense mutation and the ability to stay awake, even at 8:30 in the morning. What is the likely sequence of the Leu tRNA anticodon in the nonsense suppressor (also due to a single nucleotide change)? a.) 5’-UAG-3’ d.) 5’-UAA-3’ g.) 5’-UCA-3’ b.) 5’-CUA-3’ e.) 5’-UUG-3’ h.) 5’-UGA-’3 c.) 5’-CAA-3’ f.) 5’-UUA-3’ (14) In Saccharomyces cerevisiae, a valid name for a recessive missense mutation in “your favorite gene” is: a.) yfg1-1 e.) YFG1 b.) YFG1p f.) Yfgmut1 c.) Yfgg.) ∆yfg1 d.) Yfg+ h.) yfg1::Tn5 Bio305 Genetics Fall 2003 (15) The DNA sequence of a gene from four independently isolated mutants is given below. What is the sequence of the wildtype gene in this region? Mutant Mutant Mutant Mutant 1 2 3 4 GAATCTTTCCGTACATTAACCGGGCTAGCTCTA GAATCTTACCGTACATTAACCGGGCTACCTCTA GAATCTTACCGTAGATTAACCGGGCTAGCTCTA GATTCTTACCGTACATTAACCGGGCTAGCTCTA a.) GAATCTTACCGTACATTAACCGGGCTACCTCTA b.) GAATCTTACCGTAGATTAACCGGGCTAGCTCTA c.) GATTCTTACCGTACATTAACCGGGCTAGCTCTA d.) GATTCTTTCCGTAGATTAACCGGGCTACCTCTA e.) GAATCTTTCCGTACATTAACCGGGCTAGCTCTA f.) GAATCTTACCGTACATTAACCGGGCTAGCTCTA (16) What enzymatic activity is located in a prokaryotic 50S ribosomal subunit? a.) Peptidyl transferase d.) Aminoacyl-tRNA synthase g.) Endonuclease b.) Helicase e.) RNA polymerase III h.) None c.) Poly(A) adenylase f.) Exonuclease (17) How many amino acids can substitute for tryptophan by a single-base substitution within the Trp codon? a.) 1 b.) 2 c.) 3 d.) 4 e.) 5 f.) 6 g.) 7 h.) 8 i.) 9 (18) After growing a 15N strain of bacteria in a medium containing 14N for a single generation, Meselson and Stahl centrifuged the bacterial DNA. How many DNA containing bands were there in the tube after centrifugation, and of what density was it (or were they) (15N = heavy, 14N = light)? a.) 1 heavy band c.) 1 heavy and 1 light band e.) 1 heavy and 1 intermediate band g.) 1 heavy, 1 light and 1 intermediate band b.) 1 light band d.) 1 intermediate band f.) 1 intermediate and 1 light band (19) A nucleosomal core comprises how many histone subunits? a.) 2 b.) 4 c.) 5 d.) 6 e.) 8 f.) 10 g.) 12 h.) 14 Bio305 Genetics Fall 2003 (20) The N-terminus of a protein has the sequence Met-Thr-Tyr-Lys-His-Gly. How many different DNA sequences could encode this peptide? a.) 16 e.) 256 b.) 32 f.) 512 c.) 64 g.) 1024 d.) 128 Short answer (4 points each): (21) In 10 words or less describe what genetic process is occurring in a “puff” of a polytene chromosome. (22) In 20 words or less, describe the role of the RNA in the telomerase enzyme (be specific or you won’t get credit). (23) In 20 words or less, describe what a complementation test is used for. (24) In 20 words or less, describe why the Ds element doesn’t transpose in maize strains lacking the Ac element? Bio305 Genetics Fall 2003 (25) Kornberg performed several elegant experiments showing that DNA polymerase I was capable of accurately copying DNA and he initially proposed that this polymerase was responsible for the bulk of DNA replication in a living bacterial cell. How did the isolation of the polA1 mutation affect his hypothesis (in 20 words or less)? ...
View Full Document

Ask a homework question - tutors are online