{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}


Exam+1+--+Fall+2002+--+ANSWERS+_do+not+distribute_ - -WnlJS...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
tg ftfir #% *,-WnlJ}S Genetics F all 2002 Your Name Signature Student number Section Number: Graduate Student Instructor: Please write your name on every page' For the multiPle choice questions, cIRcLE TI'E 'INGLE BEsr RES*.NSE oN TI'E BorroM oF THrs pAGE. you might also want to circle the correct answer on your examination sheet' For the written Problems. SHOW YOUR CALCUALTIONS, ANd EXPLAIN YOI.IR WORK CLEARLY AND NEATLY. Otherwise, we will not be able to grant partial credit' WRITEYOURANSWBRSUSINGANON.ERASABLEPEN.OTIIERWISEwE wLLNoTBEABLEToCONSIDERAI\iYREQI.IESTSFoRREGRADING. Blank paper has been attached tqt!: "-YTj"-gI:I9::":Tii :3tI'-, r,''rTD Er\. A ;;ffi[Tiiui"rrirll ANSwEns rN rnr nrotilrnu splru --2 "[email protected] abj" d e f g h @u.d:Ie a b c d\.[!e h abcaNt uU: d e f " b(9 d e f s h i j a uQa ",Ag Bb .I "Ure ) abc\)ef g (1) (2) (3) b.f t.A.l (6) (7) (8) M (10 ,* (11) -+ p{ -+(}d 6 F{ (16) -trat (18) (1e) (20) Qucdefeh 6o:g€r e h a bpnf$e f s auYSer s0 "0Nd f a b c d e [email protected] @ n:.d "Sf "lQd s "U: d e f g a l($a e f g h r-20 48 ./ zr 11 lzz 'l// it {"'
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
I ..0305 Genetics Fal] 2002 r. one tecrrnique used for determining the base composition of doubre-stranded DNA yields the value of the ratio of tA]i ic]. If this ratio is ui, wrrat are tiie relative amounts of each four bases? b.) 10% L, 30oh c, l}ohT, 30oh G fo) r z.sx A,31 .sYoc, lz'svoT ,37 s%G \7 n ZSY, A, 25o/o C, 25oh T' 25oh G ( r ,-\/< 'lL. " \2. A particular protein has the amino acid sequence. ..Ara-pro-HisiTrp-Lys-Gly" "A mutation resulted in a truncated product with Trp as the terminal amino acid' what DNA single-base change (in the RNA-like strand) would cause this' \ a.) 10%A, 40o/o C, I\oh T, 40% G c.) 10% A,30ohC,30oh T,,30% G e.) 37 .5% A,12.5o/o C,37 '5o/oT,12'syo G g.) 15% A,45Yo C,ls%oT,45oh G \ a.) an A to G tansition c.)aGtoAtransition e.)aCtoAtransversion g.)aTtoGtransversion nAtoTtransversion 3. From A cross between x* Y* z't andx- y- z-sffains of Neurospora' you obtain the following octad: ) -{ 7- 'l- /r\ ^- -L^ \r ' t' \ x*y'z ++ xyz- x* v* z* \ u' * -+ + ) xvz -) x y z {c\ xY-zr -++ xyz dL'Yr M 7.'t"l' Which statement best describes this pattern: i(a.iR"combination between x and z' gene converslon \J bJ.Recombination d.)aGtoTtransversion f.)aCtoTtransition h.)aTtoAtransversion in heteroduplex region that repaired y- to y* y* to y- \$ecombination Y andz' \^1Two recombination events (a doubie crossover). One between x and y' the second y andz' Recombination x and z, no gene converslon f.) No recombination x and z, geneconversion g.) No recombination
Background image of page 2
Bio305 Genetics Fatl 2002 4' The bases of the lagg-iqgstrand of DNA in a region *t "[email protected] begins are shown below. What is the sequen*iTffi primer that is syntheJized ro.nil.*. .rtary to the bases in bold? 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3' .-{J 5' ATTCGTATA 3' y{s' AWCGUAUA 3, -l"15, TAAGCATAT 5, @, TATACGAAT -W,UAUACGAAU 3, w5'AUAUGCIruA Ms, UAAGCAUAU -y.fs'ATATGCTTA 5' You have isolated a his3 mutation in E. coli that results in the inability of the cells to grow on Complete-His media. In order to make predictions concerning the molecular nature of the mutation, you treat cells with several mutagens and examine the ability of tn. mutagenized cells to grow in media lacking histidine' For these studies, you mutagenize with either prIflavin (an intercalating
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 9

Exam+1+--+Fall+2002+--+ANSWERS+_do+not+distribute_ - -WnlJS...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online