{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

DNA_prob_key - possible anticodon sequences that it could...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
C G T A C C A C T G C A DNA G C A T G G T G A C G T double helix G C A U G G U G A C G U mRNA transcribed C G U A C C A C U G C A tRNA anticodon Ala Trp STOP P N/A amino acid translation antisense sense 3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’ Transcription problem solving key (Problem 1) Transcription problem solving key (Problem 2) 5’ - GGCGAUGGGCAAUAAACCGGGCCAGUAAGC - 3’ MET GLY ASN LYS PRO GLY GLN STOP antisense DNA 3’ - CCGCTACCCGTTATTTGGCCCGGTCATTCG - 5’ 5’ - GGCGATGGGCAATAAACCGGGCCAGTAAGC - 3’ sense DNA What happens if there is a base substitution in the third position of the second codon? nothing; it is a silent substitution What happens if there is an insertion of an A after the second codon? frameshift/nonsense mutation; MET-GLY-LYS-STOP Transcription problem solving key (Problem 3) If a tRNA molecule carries a glutamic acid, what are the two
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: possible anticodon sequences that it could contain? Be speciFc about the 5’ and 3’ ends. codons for glutamic acid = 5’ - GAA - 3’ 5’ - GAG - 3’ tRNA anticodons then must be = 3’ - CUU - 5’ 3’ - CUC - 5’ Transcription problem solving key (Additional problem) antisense DNA 5’ - CCGCTACCCGTTATTTGGCCCGGTCATTCG - 3’ Given the following sequence, provide the sense strand, the mRNA, and subsequent amino acids that will be translated. Be sure to label 5’ and 3’ ends 3’ - GGCGATGGGCAATAAACCGGGCCAGTAAGC - 5’ sense DNA 3’ - GGCGAUGGGCAAUAAACCGGGCCAGUAAGC - 5’ mRNA MET THR GLY THR ASN ASN GLY STOP...
View Full Document

{[ snackBarMessage ]}