Introduction to Genetic Analysis 422

Introduction to Genetic Analysis 422 - on File 44200...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Problems 33 44200 GRIFFITHS FREEM Ch-12 First Pages Sen 12-10-2003 p 33 Application File on File Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the H. sapiens genome. b. Translate the sequence contig in all possible read- ing frames. c. Go to the BLAST page of NCBI (http:// www.ncbi.nlm.nih.gov/BLAST/ and see Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for protein–protein comparison (BLASTp). 32. A Neurospora geneticist wanted to clone the gene cys-1, which was believed to be near the centromere on chromosome 5. Two RFLP markers (RFLP1 and RFLP2) were available in that vicinity, and so he made the following cross: Oak Ridge cys-1 3 Mauriceville cys-1 1 (See Solved Problem 1 for an explanation of the Oak Ridge and Mauriceville strains.)
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.
Ask a homework question - tutors are online