10test1answersweb - Question 1c E 550 bp RFLP analysis A...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Question 1c RFLP analysis these fragments will be same restrict with enzyme A .. we can ignore other restriction fragments E E A A A E E 550 bp 420 bp 170 bp 800 bp 250 bp 750 bp same in any rabbit Homozygous (A site present) Homozygous (A site absent) Heterozygous Alternatively, digest rabbit DNA, run on gel for Southern hybridization where probe is region of polymorphic site (or whole region shown in schematic) 1050 bp 800 bp 250 bp
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
ATG 3’ Gene X Gene Y AAT TAG GTA 5’ 5’ 3’ mRNA mRNA 5’ 5’ 3’ 3’ Question 2b One possible arrangement: or ATG Gene X Gene Y TAG 5’ 5’ 3’ 3’ AAT GTA 5’ 3’ 3’ 5’ mRNA Normally, bacterial mRNAs have short UTRs and do not overlap with other genes RNAs from other genes ... but if 3’ UTR of gene X mRNA were to extend into coding region of gene Y, amplicon would contain gene B sequence. ...
Background image of page 2
Question 3 GCUUAGAAUUCAAGGAUGUUACUCAGGUUAAUGCCACUCUA UCUGCGGUCUCAUUAACUACUUCGCGUCUUAAGAUCGACU AAAA
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/16/2011 for the course BPS 3101 taught by Professor Bonen during the Fall '09 term at University of Ottawa.

Page1 / 6

10test1answersweb - Question 1c E 550 bp RFLP analysis A...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online