{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

final_exam_rough_marking_scheme_2007

final_exam_rough_marking_scheme_2007 - BCH3356 Molecular...

Info icon This preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
BCH3356 : Final Exam, page 1/12 BCH3356 Molecular Biology Laboratory Final exam: This exam is worth 40 % of the final mark for BCH3356 Name:_______________________ Student number:_______________ Instructions All questions should be answered within the space provided on THIS COPY EXAM. You may use the endorsement of pages for your draft calculations. Students are allowed to use a calculator.
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
BCH3356 : Final Exam, page 2/12 Part I ( /20 marks): Basic Molecular Biology Techniques 1. RT-PCR You have to amplify the full length cDNA sequence coding for Taq polymerase (see appendix II for sequence detail). You should assume that the 5’ UTR and 3’ UTR are not necessary for the intended experiment. a. Assuming that you have access to the appropriate mRNA template, describe a pair of primers that could be used to generate the full length cDNA sequence. In you answer, indicate the sequence for each of the two cDNA strands at and around the binding positions of the two primers. Also include the sequence for each of the two primers and their annealing strand. Primers in blue b. Which of the two primers should be used for the RT step? The negative primer depicted at the top right above is to be used for RT c. How the cDNA or RT-PCR products would be affected if the two primers were added for the RT step? Addition of both + and – primers for the RT would not affect the overall RT-PCR product at all as the + primer would not affect RT reaction. 2. PROBE SYNTHESIS FOR NORTHERN AND SOUTHERN ANALYSES Describe the expected result for each of the following conditions used to synthesize a digoxygenin-labelled probe complementary to the fragment 961-1821 of the Taq polymerase cDNA sequence (see sequence detail in appendix). a. All optimal conditions with primer (1) caccctggccaagaaggcgg and primer (2) tctcctcccgggccacccgc. + primer is OK - Primer is in the wrong orientation and cannot anneal in parallel with the template stretch of DNA. Will be no amplification and no probe synthesis. b. All optimal conditions but only one DNA polymerase: Taq. Taq has a high processivity, but cannot add the digoxygenin-U’s. The probe will be synthesized, but will not be labeled with digoxygenin. c. All optimal conditions but only one DNA polymerase: Pwo. DNA polymerase can incorporate digoxygenin-U’s, but has a low processivity (it takes off from the template). A mixture of digoxygenin-labeled fragments with different lengths will be amplified. Not a good amplification yield is expected given the low processivity of Pwo polymerase. d. How many digoxygenin molecules would you expect per molecule of cDNA probe?
Image of page 2
BCH3356 : Final Exam, page 3/12 This is an open question and different answers are OK if properly justified. Assuming 25% of T’s in the 961-1821 fragment, the maximum number of dig-labeled U’s could be estimated as 0.25x(1821-961) or 215. Obviously the actual number of dig-U’s per molecule of probe has to be lower than 215.
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern