quiz_2 - QUIZ 2 BIS-101D Fall 2009 Name: ID: (1) A segment...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
QUIZ 2 BIS-101D Fall 2009 N a m e : I D : (1) A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA. GGCTAGCTGC TTCC TTGGGGA CCGATCGACGAAGGAACCCC T Indicate the template strand. Label each strand with its correct polarity (5’ and 3’). (2) (a) Using the codon table, show the consequences of adenine base addition to the beginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU (b) What type of mutation the insertion of the adenine in the above example causes?
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 (3) Find glycine codons in the codon table. Isoaccepting tRNA gly have anticodons shown below. Using wobble rules, show how these two anticodons recognize the four glycine codons during the translation process. Indicate 5' and 3' end for each codon and anticodon. 3' CCG 5' 3' CCU 5' (4) Pair the folloving eukaryotic genes and RNA polymerases that transcribe them: (A) insulin gene (1) Polymerase I (B) 18S rRNA gene (2) Polymerase II (C) glycine t-RNA gene (3) Polymerase III
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 4

quiz_2 - QUIZ 2 BIS-101D Fall 2009 Name: ID: (1) A segment...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online