Lecture 6 Introduction to Meiosis

Lecture 6 Introduction to Meiosis - Announcements Lecture 6...

Info iconThis preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Announcements Lecture 6 Come to the exam knowing your assigned seat (website) and bring #2 pencils, erasers, and student ID Rules of exam
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Designing PCR Primers They must flank the DNA sequence to be amplified Typically the length of the primer is > 15 bp, but may be smaller Design 6-mer primers to use in a PCR reaction to amplify the DNA sequence shown in red : 5‘- ATTCGGATTACATCGGCATTACCGATTTAAAGCCCTTAACG -3' 3’- TAAGCCTAATGTAGCCGTAATGGCTAAATTTCGGGAATTGC -5' (Please report both your answers in the 5’ to 3’ orientation)
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4 Introduction to Meiosis Lecture 6 Fall 2010
Background image of page 4
5 Outline of Lecture 6 Chromosomes Somatic cells versus germ cells and gametes Mitosis Meiosis
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
6 Chromosomes The genetic material of each cell is divided into separate chromosomes Each eukaryotic chromosome contains a single DNA molecule of enormous length The chromosomes in the nuclei of somatic cells are usually present in pairs. Cells containing two similar sets of chromosomes (genes) are called diploid (2n) Cells containing one set of chromosomes (genes) are haploid (1n) n = number of chromosomes in haploid genome
Background image of page 6
7 Basic Chromosome Structure During mitosis or meiosis, chromosomes condense and become visible under the microscope Centromere (essential for segregation) Region where spindle fibers attach and move the chromosome during mitosis or meiosis Chromatid One-half of a replicated chromosome Two sister chromatids in replicated chromosome Chromosome
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
8 Somatic Cells versus Germ Cells and Gametes Somatic cells (2n) form the body of the organism Germ cells are required to form the gametes (1n) (egg and sperm) needed for sexual reproduction Gonads contain germ cells Testes are the male gonads in humans Ovaries are the female gonads in humans The egg and sperm fuse (fertilization) to form the zygote (2n) which gives rise to the new organism. The genetic material in the germ cells determine heredity Somatic cells are diploid Gametes are haploid
Background image of page 8
9 Life Cycle of Organism
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Heritability of Acquired Characteristics? Governor Schwarzenegger
Background image of page 10
Image of page 11
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 01/21/2011 for the course BIO SCI 65 taught by Professor Yin during the Spring '10 term at Saint Joseph's University.

Page1 / 28

Lecture 6 Introduction to Meiosis - Announcements Lecture 6...

This preview shows document pages 1 - 11. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online