S10GenQuiz1KEY - ANSWER KEY QUIZ 1 SPRING GENETICS 283 Say...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Say you have a portion of a gene: 5' CTATATAGGCGTCTGTCTGCAAATCGTCGCCGCGTAATGGTCGTTTACGTTTAACG3' 3' GATATATCCGCAGACAGACGTTTAGCAGCGGCGCATTACCAGCAAATGCAAATTGC 5' Your graduate student leaves you a piece of the mRNA: GCAAAUCGUCGCC Unfortunately they forgot to mark the 5' and 3' ends of this piece (darn grad student!). Using the RNA sequence and the DNA sequence above, answer the following questions: B 1. The template strand is: a. the top strand b. the bottom strand A 2. Transcription goes from a. left to right b. right to left D 3. The next base added to this mRNA would be: a. A b. T c. C d. G e. U E 4. If all of the RNA shown is 5'UTR, what is the second codon of the open reading frame? a. CAG b. GUG c. GCC d. CAA e. none of the above If I were to compare the primary RNA transcript for this gene to the mature mRNA which of the following would be present in both? F 5. Promoter T 6. 5'UTR T 7. Exons F 8. Introns T 9. 3'UTR C 10. Given the Fnal mature mRNA sequence from another gene: 5 ʼ -AGUUGACAUGCGGGCAAUUUCAGCGAUCUAACCGGCGUA-3
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 2

S10GenQuiz1KEY - ANSWER KEY QUIZ 1 SPRING GENETICS 283 Say...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online