{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

S10GenQuiz1KEY - ANSWER KEY QUIZ 1 SPRING GENETICS 283 Say...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Say you have a portion of a gene: 5' CTATATAGGCGTCTGTCTGCAAATCGTCGCCGCGTAATGGTCGTTTACGTTTAACG3' 3' GATATATCCGCAGACAGACGTTTAGCAGCGGCGCATTACCAGCAAATGCAAATTGC 5' Your graduate student leaves you a piece of the mRNA: GCAAAUCGUCGCC Unfortunately they forgot to mark the 5' and 3' ends of this piece (darn grad student!). Using the RNA sequence and the DNA sequence above, answer the following questions: B 1. The template strand is: a. the top strand b. the bottom strand A 2. Transcription goes from a. left to right b. right to left D 3. The next base added to this mRNA would be: a. A b. T c. C d. G e. U E 4. If all of the RNA shown is 5'UTR, what is the second codon of the open reading frame? If I were to compare the primary RNA transcript for this gene to the mature mRNA which of the following would be present
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}