S10GenQuiz2KEY - Your lab is also working on another gene,...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Say you have a portion of a gene: 5' CTATATAGGCGTCTGTCTGCAAATCGTCGCCGCGTCATGGTCGTTTACGTTTAACG3' 3' GATATATCCGCAGACAGACGTTTAGCAGCGGCGCAGTACCAGCAAATGCAAATTGC 5' Your graduate student leaves you a piece of the mRNA: GUAAACGA Unfortunately they forgot to mark the 5' and 3' ends of this piece (darn grad student!). Using the RNA sequence and the DNA sequence above, answer the following questions: A1. The template strand is: a. the top strand b. the bottom strand B2. Transcription goes from a. left to right b. right to left B3. The promoter sequence is a. off to the left b. off to the right C4. The next base added to this mRNA would be: a. A b. T c. C d. G e. U A5.What is the second codon of the open reading frame? a. ACG b. GCA c. UGC d. CGU e. none of the above True or False F6. Every mature mRNA starts with AUG F7. The polyA tail is encoded in the DNA as part of the 3'UTR T8. mRNA is translated by the ribosome from 5' to 3' T9. The 5'UTR and 3'UTR are present in both primary mRNA and mature mRNA F10. A nonsense mutation (mutation that results in an stop codon instead of an amino acid codon) will give you a shorter mRNA.
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Your lab is also working on another gene, this is the entire transcription unit: 5'ATTCTAGCTAGCATGCTACGATGCTTTACAAGCGCGTACGCCAACGCATACGATGCATATAAGTACTAA3' 3'TAAGATCGATCGTACGATGCTACGAAATGTTCGCGCATGCGGTTGCGTATGCTACGTATATTCATGATT5 The protein that is synthesized from this DNA is MET-LEU-ARG-CYS-PHE-THR-SER-ALA-TYR-VAL-ARG-CYS-ILE Based on this information B10. The template strand is a. top strand b. bottom strand You investigate a second family with a mutation in this gene. In this family the intron is retained during RNA splicing. Given the gene sequence above which of the following would be true of the mutant mRNA and mutant protein from this new family? B11. The mRNA is a. shorter than normal b. longer than normal c. same size as normal B12. The protein is a. smaller than normal b. bigger than normal c. same size as normal...
View Full Document

This document was uploaded on 02/06/2011.

Ask a homework question - tutors are online