
Bio97_09+L20 - Human gene mapping OFFI C HOURS TODAY 12-3 E...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Human gene mapping OFFICE HOURS, TODAY 12-3 McGaugh Hall 4213
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 1. Pedigree 2. collect DNA from all individuals in pedigree 3. Restriction digest 4. Gel electrophoresis 5. Southern Blot 6. Probe for change in restriction site at known genomic location 6. Probe for change in length of an SSR at known genomic location 3. PCR amplify an SSR at known genomic location 4. Gel electrophoresis * * * * * * * *
Background image of page 2
©2003 C. Brachmann 3 SSR10 SSR190 SSR8
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
©2003 C. Brachmann 4 SSR89 SSR89 5’ gggcgg gcgttctcgcatagt ccc -varying TG-- aaacctgtgacccttgaatg 3’ 3’ cccgcccgcaagagcgtatcaggg -varying AC-- tttgg acactgggaacttac 5’ 5’gggcgggcgttctcgcatagtccc tg-- 88 -- aaacctgtgacccttgaatg 5’gggcgggcgttctcgcatagtccc tg-- 69 -- aaacctgtgacccttgaatg 5’gggcgggcgttctcgcatagtccc tg-- 61 -- aaacctgtgacccttgaatg 5’gggcgggcgttctcgcatagtccc tg-- 49 -- aaacctgtgacccttgaatg 5’gggcgggcgttctcgcatagtccc tg-- 42 -- aaacctgtgacccttgaatg 5’gggcgggcgttctcgcatagtccc tg-- 38 -- aaacctgtgacccttgaatg allele 1 allele 2 allele 3 allele 4 allele 5 allele 6 pcr primer sequences in bold
Background image of page 4
©2003 C. Brachmann 5 ©2003 C. Brachmann Once you’ve identified an SSR that shows linkage, you know the genomic region for phd Then sequence genes in that region. Expect that phd people have a mutation relative to normals in the phd gene. Can use the information of phd linkage with allele 6 of SSR89 to identify others in the population likely to have phd
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
©2003 C. Brachmann 6 Applications of human genetic mapping: Clone genes implicated in human disease: Family pedigree analysis important. Criminal investigations: With >>5000 polymorphisms known in humans, RFLPs and SSRs are equivalent to genetic “finger prints”. Paternity tests: Inheritance patterns of RFLPs can resolve paternity, identify corpses or solve other “missing” cases 23andME:550,000 SNPs linked to traits/disease
Background image of page 6
©2009 C. Brachmann 7 ©2003 C. Brachmann Paternity testing Set 1 and 2 contain results from two different paternity cases. In each case, the lanes contain DNA fragments from the following sources: M = Mother C = Child A = Alleged father Q: Is the alleged father (A) the true biological father?
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
©2003 C. Brachmann 8 DNA Fingerprinting In this example, an SSR was detected by restriction enzyme
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/09/2011 for the course BIO 97 taught by Professor Edinger during the Spring '10 term at UC Irvine.

Page1 / 39

Bio97_09+L20 - Human gene mapping OFFI C HOURS TODAY 12-3 E...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online