MCDB_1A_Final_Exam_White

MCDB_1A_Final_Exam_White - Name_ TA_ MCDB 1A FINAL...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Name______________________ TA________________________ MCDB 1A FINAL EXAMINATION DECEMBER 11, 2010 Scantron instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles . 4. Write the color of your test in the space underneath the I.D. number box. 5. Fill in the entire rectangle of the best answer. Part I. Biochemistry Dr. Feinstein Questions 1-18 (3 pts each) 51 points Part II. Cell Biology: Dr. Wilson Questions 19-34 (3 pts each) 51 points Part III. Genetics: Dr. Christoffersen Questions 35-84 (3 pts each) 150 points Test Color 1 point 253 points __________________________________________________ Part I. Biochemistry Dr. Feinstein Questions 1-17 (17 questions worth 3 pts each: 51 points total) Choose the one answer that best completes the statement or answers the question. The GENETIC CODE and METABOLIC PATHWAYS are at the end of the Exam. 1. Is this the correct chemistry for peptide bond formation? A. No B. Yes MCDB 1A Final Exam White (1) Version: 1 Page: 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2. Use the following mRNA to answer the next 2 questions 5' UUACCGAUACGAUGCUUAGUUUUACGGUAUAACGAGCAG 3' How many amino acids will be in the protein synthesized by this mRNA? A. 7 B. 4 C. 5 D. 6 E. some other number 3. What will be the third amino acid? A. Serine B. Phenylalanine C. Arginine D. Tyrosine E. Some other amino acid 4. Which strand(s) of DNA in the replication fork drawn below is going to be the template for the "leading" strand"? A. neither strand B. right strand C. left strand D. both strands E. more information is required to answer the question 5. Imagine that you are a very hungry cell and suddenly get a big supply of succinate. How many ATPs can you generate from each individual succinate, including those derived from electron transport/oxidative phosphorylation? A. 13 B. 5 C. 6 D. 12 E. some other number MCDB 1A Final Exam White (1) Version: 1 Page: 2
Background image of page 2
6. Imagine that you isolate and analyze the RNA present in liver cells. You find that liver RNA is 19% C. Based on this data, how much T do you think will be present in liver RNA? A. no way to know based on the given information B. 19% C. 25% D. 31% 7. Recall the Meselson-Stahl experiment using N14 and N15 to examine the mechanism of DNA replication. Imagine that the cells were grown originally in N15 and then shifted at "time zero" to N14 media. If DNA replication proceeds by a "semi-conservative" mechanism as discussed in class, what would be the proportion of H:H to H:L to L:L after 2 rounds of replication? A. 0:4:2 B. 2:2:2 C. 0:2:2 D. 0:2:4 E. some other ratio 8. Post translational modifications of proteins may include: A. Cleavage of the peptide chain into two or more fragments B. Disulfide bond formation C. Glycosylation D. A and B only E. A, B, and C 9. The first reaction of glycolysis serves to add a phosphate to glucose to produce glucose- 6-phosphate. Why does this reaction require the use (i.e., hydrolysis) of an ATP?
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 21

MCDB_1A_Final_Exam_White - Name_ TA_ MCDB 1A FINAL...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online