{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

img061 - 46.‘ 47 48 49 50 A primer having the sequence...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 46.‘ 47. 48. 49. 50. A primer having the sequence 5'TTCCAGCTAAT is extended with the Klenow fragment of DNA polymerase I in the presence of, deoxyGTP, deoxyTTP, deoxyATP, dideoxyCTP and using a DNA template having the sequence 3'AAGGTCGATTCAGATTGCTGGACTASI. Which of the following sequences corresponds to the expected product(s) of this reaction? A. 5'TTCCAGCTAAG3' B. 'TTCCAGCTAAGT3 \,7_._'C:3TTCCAGCTAAGTC3' D. S'TTCCAGCTAAGTCTAACGACCTGATT E. None of the above Which of the following statements is FALSE? A. Some restriction enzymes cut DNA to give overhanging 3‘ ends. / B. Some restriction enzymes cut DNA to give overhanging 5‘ ends.” C. Some restriction enzymes cut DNA to give blunt ends./ ”D ,Restn'ction enzymes from bacterial sources ordinarily do not cut DNA from a any ,/_eucaryotic organisms. (/23 ‘J’ '” ' ’ yone of the above. Which mutation in the coding region of mRNA is most likely to be lethal? A. Insertion of three nucleotides B. Deletion of three nucleotides CG Deletion of two nucleotides D. Substitution of C for T E. Substitution of C for A Consider the lac operon of Ecolz'. In the absence of glucose and lactose: A. RNA polymerase binds to the lac promoter and transcribes the lac operon. B. CBP protein binds to the lac operator. C. CBP protein displaces the lac repressor from the lac operon. D) lac repressor isbound to the lac operon. E. none of the above. When the intracellular concentration of tryptophan is low: i \‘f-J A/ trp repressor binds to the trp mRNA lea/(gr region B. trp repressor binds to the trp operon . lfiaw'» cQMQ‘ix ‘J‘NLLY L C1 C. transcriptional attenuation of the trp operon is relieved by binding of tryptophanyl- tRNA to the trp repressor Di trp repressor binding to the small subunit of the ribosome stimulates transcription of (_\the trp operon. @yfip repressor does not bind to the trp operon in the absence of tryptophan. ...
View Full Document

{[ snackBarMessage ]}