{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

img081 - (figure for#45...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: (figure for #45) —----——__..__.._- ---_.__-------....-- _--_-———--——--—----- ----..___..—-----—-..._.— 46. A primer having the sequence 5'TTCCAGCTAAs' is extended with the Klenow fragment of DNA polymerase I in the presence of deoxyG'J'P, deoxyITP, deoxyATP, dideonyTP and using a DNA template having the sequence, 3 AAQCTCGAI’ECAGA’ITGCTGGACTAS . Which of the following sequences corresponds to the {exfigétédproducdfi of this reaction? A. 5"I'I‘CCAGCTAAG3' B. 5' CCAGCTAAGT3 ‘. Q. ‘5, f5- ulflx‘ ii“ 24? ‘ ‘ ii ' M kW 0i) ‘4’ D. yTl‘CCAGCTAAGTCTAACGACCTGATT _ E. None of the above .t/” (2.5.2:: *-/ 47. Which of the following statements is FALSE? A. Some restriction enzymes cut DNA to give overhanging 3' ends.\/ B. Some restriction enzymes cut DNA to give overhanging 5' ends. ‘/ C. Some restriction enzymes cut DNA to give blunt ends. . Restriction enzymes from bacterial sources ordinarily do not cut DNA from /D\. i/ eucaryotic organisms. t‘QgMCAQO“ 04W CU)” 0J9 (4 WQM E. None ofthe above. (“0va g c 2; W5 a. 48. Which mutation in the coding region of mRNA is most likely to be lethal? M Insertion of three nucleotides 3 A . . n SW ; i, [Bf Deletion of three nucleotides ( ”J a” C Deletion of two nucleotides v OHIO/51.00 '3 0? 1 fMing‘fdv‘LS D. Substitution of C for T E. Substitution of C for A 49. Consider the lac operon of E. call. In the absence of glucose and lactose: A. RNA polymerase binds to the lac promoter and transcribes the lac operon. B. CBP protein binds to the lac operator. C. CBP protein displaces the lac repressor from the lac operon. @lac repressor is bound to the lac operon. "ii @04ch $1 QCfJa'Ja. {mew r E. none of the above. ) i yo?! [ n6 r M ‘ S d 50. When the intracellular concentration of tryptophan is low: 0 ON A. hp repressor binds to the np mRNA leader region. B. tip repressor binds to the hp operon. C. transcriptional attenuation of the trp operon is relieved by binding of tryptophanyl- tRNA to the tip repressor. “ D. hp repressor binding to the small subunit of the ribosome stimulates transcription of if the trp operon. r9 weepressor E. trp repressor does not bind to the tip operon in the absence of tryptophan ...
View Full Document

{[ snackBarMessage ]}